SNORA42 was cloned as described previously.21 (link) A pCDH vector (System biosciences, Mountain view, CA, USA) was used for ectopic over-expression of SNORA42. The pCDH vector encoding intact sequence of SNORA42 cDNA or empty vector as a control was infected into HEK293T cells together with pPACKH1 Packaging Plasmid mix (System biosciences) for producing viral particles using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Further information is provided in the Supplementary material and methods .
Pcdh vector
Manufactured by System Biosciences
Sourced in United States
The PCDH vector is a plasmid-based expression system designed for the exogenous expression of protocadherin genes in mammalian cell lines. The vector provides a convenient platform for the study of protocadherin protein function and localization in a controlled cellular environment.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Geneamp pcr system 9700, by Thermo Fisher Scientific (3 mentions)
Ha nik, by Addgene (2 mentions)
Prl tk constitutively expressing renilla luciferase, by Promega (2 mentions)
Pgem t easy, by Promega (2 mentions)
Ppackh1 packaging plasmid mix, by System Biosciences (1 mentions)
Effectene transfection kit, by Qiagen (1 mentions)
Gv287 vector, by Genechem (1 mentions)
Nuclear and cytoplasmic protein extraction kit, by Beyotime (1 mentions)
Flag peptide, by Merck Group (1 mentions)
Anti flag m2 magnetic bead, by Merck Group (1 mentions)
Tumor necrosis factor (tnf), by Thermo Fisher Scientific (1 mentions)
Bay11 7085, by Selleck Chemicals (1 mentions)
Jax mice, by Jackson ImmunoResearch (1 mentions)
Px330 mcherry vector, by Addgene (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
2 mercaptoethanol, by Merck Group (1 mentions)
Pgl3 basic vector, by Promega (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
30 protocols using pcdh vector
1
Overexpression of SNORA42 in HEK293T
2
Lentiviral IL-4 expression in macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral constructs expressing mouse IL-4 were cloned into the pCDH vector (SBI). IL-4 cDNA was obtained from the National Center for Biotechnology Information. Lentiviralvectors were transfected with packing plasmids into 293T cells for 2 days, and the viral particles were used to infect RAW264.7 cells and BMDMs. Selection was carried out by culturing cells in medium containing 2 μg/mL puromycin for 2 days. RAW264.7 cells with IL-4 were marked as M-IL-4, and non-IL-4 cells were marked as M-Con.
3
Overexpressing miR-550-1 and WWTR1 in HEK293T
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pri-miR-550-1 sequence was amplified by PCR from healthy human BM mononuclear cells (MNCs). Primers with mutated sequences (Table 1 ) were then used to generate the indicated mutant miR-550-1 template, and these wild type (WT) and mutant miR-550-1 sequences were thereafter cloned into the MSCV-PIG vector (MSCV-Puromycin-IRES-GFP vector) (Cold Spring Harbour Laboratory, USA) in order to overexpress these two miRNA isoforms. These sequences were inserted between the XhoI (CTCGAG) and EcoRI (GAATTC) sites in this vector. For WWTR1-CDS vectors, the WT sequence was amplified from healthy human BM MNCs prior to insertion into the pCDH vector (SBI, Mountain View, USA). The MSCVneo-MLL-AF9 plasmid was kindly provided by Dr. Scott Armstrong.
One day prior to transfection, 5 ×105 HEK293T cells were plated into 60-mm dishes. Retroviruses were then produced via transfecting cells with vector DNA and a packaging vector (PCL-Eco or PCL-Ampho) with the Effectene Transfection Kit (Qiagen). The WWTR1 overexpressing lentivirus was generated via co-transfection of the WWTR1-pCDH plasmid and packaging lentivirus vectors (pRSV-Rev, pMDLg/pRRE and pMD2.G). At 48 and 72 h post-transfection, cellular supernatants were harvested and filtered through a 0.45 μm cellulose acetate filter prior to storage.
One day prior to transfection, 5 ×105 HEK293T cells were plated into 60-mm dishes. Retroviruses were then produced via transfecting cells with vector DNA and a packaging vector (PCL-Eco or PCL-Ampho) with the Effectene Transfection Kit (Qiagen). The WWTR1 overexpressing lentivirus was generated via co-transfection of the WWTR1-pCDH plasmid and packaging lentivirus vectors (pRSV-Rev, pMDLg/pRRE and pMD2.G). At 48 and 72 h post-transfection, cellular supernatants were harvested and filtered through a 0.45 μm cellulose acetate filter prior to storage.
4
Overexpression of Cebpa in Mouse Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A genomic fragment of the mmu‐miR‐486 precursor from mouse chromosome was amplified. PCR primers were 5′‐tctagataactgagccaaggatgggtgggccag‐3′ and 5′‐gcctagggcggccgctcaggggtgggggtgggt‐3′. The PCR product was cloned into the pCDH vector (Catalog number: CD511B‐1; SBI, Mountain View, California, USA) by fusion cloning. For overexpression of Cebpa, a sequence encoding the CDS region of Cebpa was cloned into the GV287 vector (Catalog number: GV287; Shanghai Genechem Co., Ltd, Shanghai, China). PCR primers were 5′‐tggccccgtgaaaaatga‐3′ and 5′‐ggaggtgcaaaaagcaaggg‐3′. Then, the vectors and pPACK packaging plasmid mix (pCMV‐R8.92 and pVSVG‐I from Shanghai Holly Biotech Co., Ltd. Shanghai, China) were co‐transfected into 293T cells with Lipofectamine 2000 (Catalog number: 11668019; Invitrogen). Forty‐eight hours later, viral particles were collected from the supernatant and subsequently purified. After titer determination, virus was stored in single use aliquots for future use at −80°C to reduce viral titer loss from freeze‐thaw cycles.
5
Lentiviral Transduction of Murine Immune Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral constructs expressing murine IL‐10, CD147, and TGFRcFC were cloned into the pCDH vector (SBI). Lentiviral vectors were transfected with packing plasmids into 293 T cells, and the viral particles were collected and used to infect RAW264.7 cells. The selection was carried out by culturing cells in a medium containing 5 μg/mL puromycin for 2 days.
6
Characterization of BRPF2-HBO1 Histone Acetyltransferase Complex
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNAs encoding full-length Flag-BRPF2 and full-length His-HBO1 were cloned into the pCDH vector (SBI). HEK 293T cells were transfected with WT or mutant full-length Flag-BRPF2 and full-length His-HBO1. Cells were harvested 48 h post-transfection, and nuclear extracts were prepared using the nuclear and cytoplasmic protein extraction kit (Beyotime). Immunoprecipitation (IP) was performed based on the method described previously (32 (link)) with modifications. Specifically, the nuclear extracts were incubated with anti-Flag M2 magnetic beads (Sigma) at 4°C for 8 h. After washing three times with the buffer, the bound protein complexes were eluted with a 3× Flag peptide (Sigma) and then subjected to HAT assays using NCPs as the substrate. In HAT assays, the 30 μl reaction mixture consisted of 20 μl eluted protein complex, 0.1 mM AcCoA and 0.05 μM NCPs. The reaction was carried out at 30°C for 60 min, and the reaction mixture was analyzed with SDS-PAGE, Coomassie blue staining and western blotting with antibodies specific to His, Flag or acetylated H3K14.
7
Lentiviral Barcode Library Generation
8
Regulation of NF-κB Signaling Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression plasmids for RELA, p50, RELB, p52, and Rel were obtained from the laboratory collection. TEX10 cDNA, TEX10RES, and truncations were cloned into the pCDH vector (System Bioscience, Palo Alto, CA, USA). RELA mutants were constructed in pcDNA3.0 vector. For transient transfection, Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, USA, #11668019) was used according to the manufacturer's protocol. TNF (PeproTech, NJ, USA, #96‐300‐01A) and BAY 11‐7085 (Selleck Chemicals, Houston, USA #S2913) were used at a final concentration of 20 ng mL−1 and 10 × 10−6m , respectively.
9
Overexpression of miR-148a in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the functional effects of overexpressed miR-148a, the pCDH vector (System Bioscience, Mountain View, CA, USA) was used as the overexpressed miR-148a system. We constructed the pCDH-miR-148a plasmid by intercalating the miR-148a PCR product into multiple cloning sites of the pCDH vector. The following PCR primer sequences were used for miR-148a cloning: GCCTGAATTCATGCTTTTAACGAGTTATTCTTC and CTAGGCGGCCGCGCCTTGCCCCTCCCCCAAGGA. The forward and reverse primers were extended by inclusion of GAATTC and GCGGCCGC sequences, respectively, creating EcoR1 and Not1 restriction sites at their 5′ end, respectively. The miR-148a overexpression vectors were confirmed through direct DNA sequencing.
10
Plasmid Sources for TRIM and Signaling Proteins
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!