All experiments using Xenopus and zebrafish were done with approval of the HMS animal care review board. Ovaries were surgically removed from adult female Xenopus laevis frogs and treated with 2 mg/mL collagenase 1A (Sigma) in 1X MMR by gentle rocking, until most of the oocytes were clearly dissociated. Oocytes were later injected with mRNAs encoding for indicated proteins by using a FemtoJet express microinjector (Eppendorf).
Femtojet express microinjector
Manufactured by Eppendorf
Sourced in Germany
The FemtoJet express microinjector is a compact and easy-to-use instrument designed for microinjection applications. It provides precise control over the injection volume and pressure, allowing for accurate and reproducible results. The device is suitable for a variety of cell types and samples.
Automatically generated - may contain errors
Lab products found in correlation
Celltracker cm dii, by Thermo Fisher Scientific (3 mentions)
Dnase 1, by Merck Group (3 mentions)
Trypsinized, by Thermo Fisher Scientific (2 mentions)
Low gelling temperature agarose, by Merck Group (2 mentions)
Tricaine, by Merck Group (2 mentions)
Phenol red, by Merck Group (2 mentions)
Phosphate buffered saline (pbs), by Lonza (2 mentions)
Collagenase 1a, by Merck Group (1 mentions)
Leica s8 apo, by Leica Microsystems (1 mentions)
Sigmacote, by Merck Group (1 mentions)
Block it rnai designer, by Thermo Fisher Scientific (1 mentions)
Benzonase, by Merck Group (1 mentions)
Qiaexpressionist kit, by Qiagen (1 mentions)
Nk2 micromanipulator, by Eppendorf (1 mentions)
Tritc dextrane, by Thermo Fisher Scientific (1 mentions)
Proteinase k treatment, by Merck Group (1 mentions)
Roswell park memorial institute (rpmi), by Thermo Fisher Scientific (1 mentions)
Injectman ni2, by Eppendorf (1 mentions)
96 well plate, by Corning (1 mentions)
Femtotip 2, by Eppendorf (1 mentions)
15 protocols using femtojet express microinjector
1
Xenopus Oocyte Preparation and mRNA Injection
2
Microinjection of Aphid Nymphs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microinjections were performed using the Eppendorf® FemtoJet® Express microinjector. The GD-1 glass capillary with filaments (NARISHIGE Group. Tokyo, JP) was used for microinjection. To prevent clogging, the capillaries were coated with Sigmacote® (Sigma-Aldrich®, Burlington, MA, USA). Fifteen glass capillaries were placed in a 15 ml centrifuge tube, to which one milliliter of Sigmacote® was added. The tube was securely covered with a lid and subjected to gentle inversion to coat the glass capillaries evenly. Following coating, the glass capillaries were air-dried in a fume hood for 14 days. Prior to injection, glass capillaries were carefully pulled into sharp needles at 60 °C using a Narishige PC-10 puller (NARISHIGE Group. Tokyo, JP).
For the microinjection procedure, second instar aphid nymphs were immobilized on a microscopy glass slide layered with a piece of Kimwipe tissue paper (Misumi Group Inc., Tokyo, JP) moistened with 70% ethanol, facilitated by a fine paintbrush. Microinjection was performed using a stereomicroscope (Leica S8 APO; Leica Microsystems, Wetzlar, DE). The injection pressure (Pi) was set to 1500 hPa, the injection duration (T) was 4 s, and the constant pressure (Pc) ranged between 400 and 700 hPa. The volume of PNAs injected into the aphid nymphs was estimated to be 0.2805 ± 0.0462 μL.
For the microinjection procedure, second instar aphid nymphs were immobilized on a microscopy glass slide layered with a piece of Kimwipe tissue paper (Misumi Group Inc., Tokyo, JP) moistened with 70% ethanol, facilitated by a fine paintbrush. Microinjection was performed using a stereomicroscope (Leica S8 APO; Leica Microsystems, Wetzlar, DE). The injection pressure (Pi) was set to 1500 hPa, the injection duration (T) was 4 s, and the constant pressure (Pc) ranged between 400 and 700 hPa. The volume of PNAs injected into the aphid nymphs was estimated to be 0.2805 ± 0.0462 μL.
3
Tumor Cell Implantation in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SK-N-BE(2)-C cells were cultured to 70–80% confluence, then washed once with PBS (Lonza, Basel, Switzerland), trypsinized (Gibco), counted and resuspended in phenol red-free Roswell Park Memorial Institute medium (RPMI, Gibco). Tumor cells were labeled by incubation with CellTracker CM-DiI (Thermo Fisher Scientific, Waltham, MA, USA) for 5 min at 37 °C, and then for an additional 15 min at 4 °C. To minimize cell clumping, DNase I (250 Kunitz units/ml, Sigma) was added to the cell suspension. Following the incubation, cells were washed twice with 10% FCS RPMI, twice with serum-free RPMI and resuspended in serum-free RPMI to a final concentration of 1.0 × 108 cell/ml. Before implantation, zebrafish were anesthetized with tricaine (0.02%, Sigma) and embedded in a lateral position in 1.0% low gelling temperature agarose (Sigma). Between 150 and 250 CM-DiI-labeled tumor cells were injected into the yolk sac of each zebrafish larva using FemtoJet express microinjector (Eppendorf, Hamburg, Germany) and glass microinjection needles (Science Products, Hofheim, Germany). Larvae were transferred to 34 °C 1 h after tumor cell injection.
4
Retinal Neuron Degeneration and Inflammatory Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Death of ganglion and amacrine retinal neurons was induced by a single intravitreal injection of 0.5–1 nL of freshly prepared 100 mM N-Methyl-D-aspartic acid (NMDA, M3262, Sigma) in water. Briefly, fish were anesthetized in 0.1% 2-phenoxyethanol, and under microscopic visualization, NMDA was delivered using a FemtoJet express microinjector (Eppendorf). Control injections were sterile water. Retinas that were coinjected with LPS and NMDA were injected at 0 h with LPS, followed by NMDA injection at 3 h. Retinas were then collected at 72 h following LPS injection.
5
Dnmt1 Knockdown in Mouse Oocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the requirement of Invitrogen Block-iT RNAi Designer and the information of Dnmt1 mRNA sequence, three Stealth siRNAs related to Dnmt1 conserved domains including the replication foci domain (RFD), bromo adjacent homology domain (BAH) and cytosine-C5 specific DNA methylase domain (DCM) were designed and synthesized (Invitrogen), and the sequences were as following: siRNA-RFD: CCCGTCTCTTGAAGGTGGTGTTAAT , siRNA-BAH: CATAGCAAAGTGAAGGTCATCTATA and siRNA-DCM: GATAAGAAGTTTGTCAGCAACATCA . Then, siRNAs were dissolved with Rnase free H2O to the concentration at 20 μM and microinjected into GV stage oocytes in 200 μl drop of manipulation medium supplemented with 7.5 μg ml-1 cytochalasin B and bovine serum albumin (BSA) using Sterile Femtotips and the FemtoJet express microinjector (Eppendorf) [11 (link)]. The injection condition was 250 hpa Injection Pressure, 60 hpa Comensation Pressure and 0.7 sec Injection Time, and approximate 10 pl siRNAs were injected into each oocyte. The same amount of negative siRNAs or Rnase free water was injected as the control, and FITC labeled nonsilencing siRNA was used to evaluate the successful rate of injection. Immediately after microinjection, oocytes were washed and cocultured with mural granulosa cells in maturation medium.
6
Xenotransplantation of Labeled Tumor Cells in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell preparation and xenotransplantation were performed as described previously [48 (link)]. Briefly, cells (NB-1 and IMR-32) were cultured to 70–80% confluence, and then harvested and labeled with CellTracker CM-DiI (Thermo Fisher Scientific, Waltham, MA, USA). To minimize cell clumping, DNase I (250 Kunitz units/mL, Sigma-Aldrich, Munich, Germany) for IMR-32 and Benzonase (E1014-25KU, Sigma-Aldrich, Munich, Germany) for NB-1 was added to the cell suspension and washed twice with 10% FCS RPMI, twice with serum-free RPMI and resuspended in serum-free RPMI to a final concentration of 1.0 × 108 cell/mL. Zebrafish embryos were anesthetized with tricaine (MS-222, 3-Amino-benzoesäure-ethylester-methansulfonat, 0.02% (w/v), Sigma-Aldrich, Munich, Germany) and embedded in 1.0% of low gelling temperature agarose (Sigma-Aldrich, Munich, Germany). 150 to 250 CM-DiI-labeled tumor cells were injected into the yolk sac of each embryo using a FemtoJet express microinjector (Eppendorf, Hamburg, Germany) and glass microinjection needles (Science Products, Hofheim, Germany). Shortly (30 min) after injection, embryos were transferred to and held at 34 °C.
7
Intravitreal Injection of Recombinant TNFα in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TNFα was synthesized according to a published method (Conner et al., 2014 (link)). Briefly, the pQE30 plasmid containing recombinant zebrafish TNFα cDNA was transfected into M15 cells (QIAGEN), and recombinant TNFα protein was purified using a QIAExpressionist kit (QIAGEN). Purified TNFα was diluted to a working concentration of 0.5 mg/mL with sterile PBS. TNFα solution (0.5–1 nL) was injected intravitreally into the eyes of 3 wpf gosh mutants and wild-type siblings using a FemtoJet express microinjector (Eppendorf). Since 3-wpf larval fish show variable body size, we selected average-sized fish from each genotype group for injection. Two rounds of injection were applied intravitreally every 12 h, and fish were sacrificed 12 h later (24 h after the first injection). Samples were immediately fixed in 4% PFA and processed for immunohistochemistry.
8
Microinjection of Fertilized Zygotes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Freshly fertilized eggs were incubated for 45 minutes at 18°C. Zygotes were prepared for microinjection by washing off the jelly coat with sea water followed by Proteinase K treatment (Merck, 50 μg/ml final concentration) for 25 seconds to soften the egg envelope. After extensive washing with sea water, zygotes were transferred to an injection stage made of 1.5% agarose submerged in sea water. Microinjections were performed using a Leica LC2 microscope, a Transferman NK2 micromanipulator, a Femtojet express microinjector, and Femtotips II microcapillaries (all from Eppendorf). A detailed account of the microinjection protocol and the used stage will appear elsewhere (Tosches et al., in preparation). Zygotes were injected with a solution containing 0.2 μg/μl of endotoxin-free DNA, 0.2 μg/μl synthetic transposase mRNA, and 0.6% (w/v) TRITC-Dextrane (MW 70 k, Invitrogen). Injected zygotes were transferred into fresh sea water and incubated at 18°C for the indicated periods.
9
Transgene Expression in Zebrafish Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For experiments that relied on tissue-specific transgene expression, fertilized eggs from atoh1a:KalTA+/− or elavl3:H2B-GCaMP6s parents were injected with either 25 ng/μl plasmid DNA alone or 100 ng/μl plasmid DNA together with 100 ng/μl mRNA encoding for transposase Tol1, prepared by in vitro transcription, using an Eppendorf Femtojet Express Microinjector. All injection mixes contained 0.05% Phenolred (Sigma Aldrich, St. Louis, MO) for injection control. Plasmid DNA was prepared using the manufacturer’s instructions (Macherey Nagel GmbH & Co., Düren, Germany). Approximately 2 nl were injected per zygote. After injection, eggs were transferred to 30% Danieau and incubated at 28°C. Embryos used in optogenetic experiments were raised in the dark.
10
Xenograft Tumor Cell Implantation in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SK-N-BE(2)-C cells were cultured to 70–80% confluence, then washed once with phosphate-buffered saline (PBS; Lonza, Basel, Switzerland), trypsinized (Gibco), counted and resuspended in phenol red-free Roswell Park Memorial Institute medium (RPMI, Gibco). Tumor cells were labeled as described previously [25 (link)]. Briefly, cells were incubated with CellTracker CM-DiI (Thermo Fisher Scientific, Braunschweig, Germany Waltham, MA, USA) for 5 min at 37 °C and then for an additional 15 min at 4 °C. To minimize cell clumping, DNase I (250 Kunitz units/mL, Sigma) was added to the cell suspension. Following the incubation, cells were washed with 10% FCS RPMI, twice with serum-free RPMI and resuspended in serum-free RPMI to a final concentration of 1.0 × 108 cell/mL. Before implantation, zebrafish were anesthetized with tricaine (0.02%, Sigma) and embedded in a lateral position in 1.0% low gelling temperature agarose (Sigma). Between 150 and 250 CM-DiI-labeled tumor cells were injected into the yolk sac of each zebrafish embryo using FemtoJet express microinjector (Eppendorf, Hamburg, Germany) and glass microinjection needles (Science Products, Hofheim, Germany). Embryo were transferred to 34 °C 1 h after tumor cell injection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!