Microspectrophotometer

According to the geographic location, isolation, size, and habitat characteristics of C. oliveri populations, 18 populations were collected from the whole distribution region in southern China, including 6 marginal and 12 central populations (Figure 1; Table S1). The central populations were located in Chongqing, Sichuan, Hubei, and Hunan Provinces, because the result of ecological niche modeling showed that these areas are the highest suitable habitat for C. oliveri (unpublished data). While marginal populations were distributed in Yunnan and Jiangxi Provinces, and isolated from central populations, with small coverage high fragmentation and low densities. Fresh needles were collected from 330 individuals and desiccated with silica gel for subsequent use. Geographic and altitude information were obtained via GPS. Cetyltrimethylammonium bromide (CTAB) approach modified by Su et al. (2005 (link)) was operated for genomic DNA extraction. The concentration and quality of DNA were assessed using micro‐spectrophotometer (ThermoFisher) and 1.0% agarose gel electrophoresis, respectively.

Total RNA from glomeruli or cultured cells was extracted using TRIzol reagent (Thermo Scientific Inc., MA, USA) and its concentration was measured on a microspectrophotometer (Thermo Scientific Inc., MA, USA). The RNA quality was tested by agar gel electrophoresis followed by cDNA synthesis. cDNA was amplified from RNA using a commercial kit (Bio-Rad, Hercules, CA, USA). Primer sequences are shown in . Real-time PCR was performed with the CFX96TM Real-Time System (Bio-Rad, Hercules, USA) using SYBR Premix Ex Taq™ (Tli RNaseH Plus Takara) as previously described [16 (no link found, link)]. The housekeeping gene GAPDH or β-actin was used as an internal standard. PCR reactions were carried out in a volume of 20 ml on a CFX96 RealTime PCR System (Bio-Rad) with SYBR Green kit (Tli RNaseH Plus, Takara), followed by melting curve analysis to distinguish the specific and non-specific PCR products. The relative expression of each gene was calculated using the 2^−ΔΔCt method.

Utilizing TRIzol Reagent (Beyotime), total RNA was isolated and then identified by a micro-spectrophotometer (Thermo Fisher, Waltham, MA, USA). RNA was assembled into cDNA using SuperScript™ III First-Strand Synthesis System (Thermo Fisher) or using miRNA First Strand cDNA Synthesis Kit (TianGen, Beijing, China), followed by qPCR using SYBR GreenER™ qPCR SuperMix (Invitrogen). Internal references used here were GAPDH and U6. The 2^−△△Ct method was employed to calculate relative expression. The sequences of primers were listed in Table 1.Table 1

Primers sequences used for qPCR

Name		Primer sequence (5′–3′)
circTBX5(hsa_circ_0003176)	Forward	AATGTCAAGAATGCAAAGAGCAG
	Reverse	CTTTGATTCCCTCCATGCCCT
MyD88	Forward	GCATATGCCTGAGCGTTTCG
	Reverse	GTGGCCTTCTAGCCAACCTC
miR-146b-3p	Forward	GATTAGGCCCTGTGGACTCA
	Reverse	CTCAACTGGTGTCGTGGAGTC
miR-558	Forward	CTCCGAGTGAGCTGCTGTAC
	Reverse	TCAACTGGTGTCGTGGAGTC
miR-637	Forward	TTTAGACTGGGGGCTTTCGGG
	Reverse	CTCAACTGGTGTCGTGGAGTCG
miR-645	Forward	GATTCCGAGTCTAGGCTGGTAC
	Reverse	TCAACTGGTGTCGTGGAGTC
GAPDH	Forward	CAAATTCCATGGCACCGTCA
	Reverse	GACTCCACGACGTACTCAGC
U6	Forward	CTTCGGCAGCACATATACT
	Reverse	AAAATATGGAACGCTTCACG

The method of Trizol was used to extract the total RNA from the gills and livers, and the concentration and purity of RNA were determined by using a microspectrophotometer (Thermo Fisher Scientific, USA). The cDNA was synthesized with total RNA using the reverse transcription kit [PrimeScript (r) RT Reagent Kit with gDNA Eraser] according to the instructions.
After determining the amplification efficiency of primers (>90%, Table 1), the relative expressions of HIF-1α (in gills), TNF, IL-8, and IFN (in livers) were detected by qPCR. The qPCR was conducted on the 7500 Real-Time PCR System (Applied Biosystems, USA) using the 2× SYBR Green qPCR Mix (Antibody, ROX) (Genenode Biotech Ltd., Cat# 4302). The mixture of qPCR included 1 μl of cDNA, 0.25 μl of forward and reverse primers, and 5 μl of 2× SYBR Green qPCR Mix (Antibody), and the RNase-free ddH₂O were added to fill a total volume of 10 μl. After full mixing, the following qPCR procedures were executed: 95°C for 3 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. Finally, the relative expression levels were measured by using the 2^−ΔΔCt method using β-actin as an internal reference.

The expression of osteogenic genes of magnetic nanoparticles was quantitatively determined by RT-qPCR. In this study, BMSCs were co-cultured with material extracts containing osteogenic differentiation medium for 7 days. To analyze RNA expression, each well was washed with PBS and fully cleaved with lysate. RNA of the samples was extracted by Hipure Total RNA Micro Kit (Magen) according to the kit instructions. RNA concentration was detected by a microspectrophotometer (Thermo scientific). We then reverse-transcribed the extracted RNA into cDNA using the Transcript First Strand cDNA Synthesis Kit (Roche). According to the manufacturer’s protocol, relevant osteogenic differentiation gene primers and SYBR green reagent were added for RT-qPCR. The instrument of RT-qPCR detection was performed using StepOnePlus real-time PCR system (Thermo Fisher Scientific). Osteogenic gene primers were listed in Table 2.

Total RNA was extracted using the TRIzol reagent, and its concentration was determined using a microspectrophotometer (Thermo Fisher Scientific). RNA was reverse transcribed into cDNA using the PrimeScript™ RT reagent kit (RR047A; Takara Bio, Japan) under the following conditions: 37°C for 15 min, 85°C for 5 s, and standby at 4°C. PCR was performed using the TB Green™ Premix Ex Taq II reagent kit (RR820; Takara Bio, Japan). The reaction conditions were as follows: pre-denaturation at 95°C for 30 s; 40 cycles of 95°C for 5 s; 60°C for 34 s; dissolution curve: 95°C, 15 s; 60°C, 1 min; 95°C, 15 s. The amplification and melting curves were obtained after completion of the reaction and the expression of target gene was analyzed using the 2^-∆∆CT relative quantitative method. The sequences of the PCR primers are as follows (Table 2):