First strand cdna synthesis kit

For qRT-PCR, total RNA was isolated with TRIzol reagent (Invitrogen), and cDNA was synthesized using the First Strand cDNA Synthesis kit (Yeasen). For the quantitative real-time PCR (qRT-PCR), the SYBR Green Supermix kit (Yeasen) was used on the StepOnePlus™ Real-Time PCR System (Applied Biosystems). The primer sequences for qRT-PCR were as follows:
Western blotting procedures were described in our previous study (18 (link)). The primary antibodies used were MISP (1:1,000, cat.no. 26338-1-AP, Proteintech); ZO-1 (1:1,000, cat. no. 8193P; Cell Signaling Technology); ZEB1 (1:1,000, cat. no. 70512S; Cell Signaling Technology), N-cadherin (1:1,000, cat. no. 13116T; Cell Signaling Technology); vimentin (1:1,000, cat. no. 3932S; Cell Signaling Technology); E-cadherin (1:1,000, cat.no. 20874-1-AP, Proteintech.), Slug (1:1,000, cat. no. 9585T; Cell Signaling Technology, Inc.) and β-actin (1:2,000, cat.no.GB12001, Servicebio.), GAPDH (1:2,000, cat.no. GB12002, Servicebio.); HRP-linked secondary antibodies (1:5,000; cat. no. 7074P2 and 7076S; Cell Signaling Technology, Inc.).

According to the manufacturer’s instructions, total RNA was isolated from post-infected and non-infected cells via TRNzol Universal Reagent kit (TIANGEN, Beijing, China). Then, RNA was inverse transcribed to cDNA with the first strand cDNA synthesis kit (Cat No.11119-11141; Yeasen, Shanghai, China) and reverse transcription PCR (RT-PCR).

Immunoblotting procedures were described in our previous study.²⁰ Cytoskeletal fractions were obtained using a ProteoExtract Subcellular Proteome Extraction Kit (Merck Millipore) according to the manufacturer's instruction. Primary antibodies are shown in Table S1. Immunoreactivity was detected by the Enhanced Chemiluminescence kit (GE Healthcare), and visualization was performed with the G BoxChemic XL system (Syngene). GAPDH was used as an internal reference control for the relative protein expression levels using the Quantity One software (Bio‐Rad). For qRT‐PCR, total RNA was isolated with TRIzol reagent (Invitrogen), and cDNA was synthesized with the First Strand cDNA Synthesis kit (Yeasen), following the manufacturer's instructions. For quantitative reverse transcriptase‐PCR, SYBR Green Supermix kit (Yeasen) was used on a StepOnePlus™ Real‐Time PCR System (Applied Biosystems). Primer sequences for qRT‐PCR were as follows: SKA1 forward: ACCCAGAGCTGTGTTAAGGGA, SKA1 reverse: TTGGGAGGCTTCTTT ACGGGT; GAPDH forward: GGTGAAGGTCGGAGTCAACG, GAPDH reverse: TGGGTGGAATCATATTGGAACA. The relative gene expression levels were determined by the comparative CT method (2^−ΔΔCT). The results were expressed as relative integrated intensity.

According to the manufacturer’s instructions, total RNA was isolated from postinfected and noninfected cells using the FastPure® Cell Total RNA isolation kit (RC112-01, Vazyme Biotech Co., Ltd., China). RNA was reverse transcribed to cDNA with the First Strand cDNA Synthesis Kit (Cat No. 11,119–11,141; Yeasen, Shanghai, China), and reverse transcription PCR (RT‒PCR) was performed. The total volume of the reaction was 10 µL, and the thermocycler program was as follows: 94 °C for 10 min and 40 cycles of 94 °C for 20 s, 58 °C for 20 s, and 72 °C for 20 s. The relative mRNA levels were calculated using the 2 − ΔΔCt method [24 (link)]. GAPDH was used as an internal control.

Total RNA of DVSMCs was extracted using TRIzol reagent. Complementary DNA (cDNA) samples were synthesized using the First Strand cDNA Synthesis Kit (Yeasen, Shanghai, China) and oligo (dT) primers. The levels of mRNA of the target genes were examined using SYBR Green PCR Master Mix. The following primer pairs were used:
IL-9
Forward: TCA AGATGCTTCTGGCCATG
Reverse: AGGGAATGCCCAAACAGAGA
IL-9R
Forward: CCAGCACAGGGATCACATTG
Reverse: GCCTGTATAACGCTCCTCCT
β-actinForward: AACCATGAGGGAAATCGTGC
Reverse: CAGGATGGCACGAGGAACAT
The 2^−ΔΔCt method was used to normalize the transcription to the level of β-actin and to calculate the fold-induction relative to the controls.