The largest database of trusted experimental protocols

Pd0325901

Manufactured by Merck Group
Sourced in United States

PD0325901 is a small molecule inhibitor of the mitogen-activated protein kinase (MEK) enzyme. It is a laboratory research tool used to study cellular signaling pathways involving the Ras/Raf/MEK/ERK cascade.

Automatically generated - may contain errors

153 protocols using pd0325901

1

Investigating MEK1/2 Inhibition in Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MEK1/2 inhibitor compounds PD0325901 (catalog # S1036), CI-1040 (catalog # S1020), and trametinib (catalog # S2673) were purchased from Selleck for use in in vitro cell culture experiments. PD0325901 and trametinib were used at 0.5 μM and CI-1040 was used at 10 μM. PD0325901 (catalog # PZ0162) used for in vivo experiments was from Sigma. Recombinant human M-CSF (catalog # 300-25) and murine M-CSF (catalog # 315-02) were from Peprotech. Ficoll Paque Plus (catalog # 17-1440-03) was from Cytiva. Human AB serum was from Sigma (catalog # H6914). LPS from Pseudomonas aeruginosa was from Sigma (catalog # L8643). Pam3CSK4 (catalog # tlrl-pms) and FSL1 (catalog # tlrl-fsl) were from InvivoGen (San Diego, CA). The pHrodo Red E. coli (catalog # P35361), S. aureus (catalog # A10010), and zymosan (catalog # P35364) bioparticles were from ThermoFisher Scientific. Antibodies used in these studies are listed in Supplementary Table 1.
+ Open protocol
+ Expand
2

Modulating B cell activation pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following reagents or chemicals were used in this study: MEGA-CD40L (Enzo Life Sciences catalog no. ALX-522-110-C010, 50 ng/ml), CpG (IDT, TCGTCGTTTTGTCGTTTTGTCGTT, 1 μM), αIgM (Sigma, catalog no. 10759, 1 mg/ml), IL-4 (R&D Systems, 204-IL-050, 20 ng/ml), αIgG (Agilent, A042402-2), cytidine (Sigma, C122106, 200 mM), uridine (Sigma, U3003, 200 mM), 4-hydroxy tamoxifen (4HT; Sigma, H7904-25MG), doxycycline (Sigma, D9891-1G), sodium butyrate (ALFA AESAR AAA1107922), IKK inhibitor VIII (Calbiochem, catalog no. 401487), and MAPK/ERK inhibitor PD0325901 (Sigma, PD0325901). For rescue experiments, cytidine (200 μM) and uridine (200 μM) were added 2 days after puromycin selection for the indicated periods.
+ Open protocol
+ Expand
3

PD0325901 Treatment in Dfb Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
PD0325901 (Sigma-Aldrich) was dissolved in ethanol at a concentration of 5 mg/mL and prepared in saline at a concentration of 0.125 mg/mL. PD0325901 (1.0 mg/kg/body weight) was intraperitoneal injected into anesthetized mice daily from days 12 to 21 after the start of Dfb application (Supplementary Fig. 5a).
+ Open protocol
+ Expand
4

Bovine Fibroblast Reprogramming with iPSC Media

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bovine FFs were obtained from 40 to 45 day-old male fetuses and cultured in IMDM medium. For the reprogramming protocol, the isolated fibroblasts were seeded 24 h before lentivirus transduction on 0.1% gelatin-coated wells of a 6-well plate at a density of 2 × 104 cells/well. A fresh medium with lentivirus stock was added to the culture medium, incubated overnight, and replaced by a lentivirus-free medium the following day (transduction was considered day 0). On day 5, the cells were harvested with TrypLE and transferred into an MEF feeder, inactivated by mitomycin-C. MEF feeder layers with reprogrammed cells were cultured in iPSC medium, supplemented with 10 ng/ml bFGF [cat. 100-18B, Peprotech] or ESGRO® Recombinant Mouse LIF Protein [cat. ESG1106—Millipore] associated or not with 2i (1 mM PD0325901 [cat. 444968, Sigma] and 3 mM CHIR99021 [cat. 361571, Sigma]) at 38.5°C, 5% CO2, and 5% O2 in a humidified atmosphere. Experimental groups were denominated based on their supplementation, such as bFGF, bFGF2i, LIF, and LIF2i. Additionally, biPSCs were frozen once they reached ∼70% confluency in cryopreservation medium consisting of 90% iPSC medium and 10% (vol/vol) DMSO.
+ Open protocol
+ Expand
5

Ionizing Radiation Response in BMDMs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The BMDMs were irradiated on day 6 with 2, 6, or 20 Gy of IR (for 6 Gy, ~1.6 Gy per min with Gulmay X-ray unit). RNA was harvested in Tri reagent (Molecular Research Center Inc, #TR118). For inhibitor studies, BMDMs were preincubated for 1 hr with ROS scavenger NAC (100 µM or 1mM, Sigma), ERK inhibitor PD0325901 (5 µM, Sigma), or p38 inhibitor BIRB0796 (5 µM, AXON Medchem).
+ Open protocol
+ Expand
6

Generation of Anti-CD19 CAR-NK iPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
MUSIi013-A cells were transduced with lentiviral particles carrying the anti-CD19 in the presence of 4 μg/mL hexadimethrine bromide (Sigma-Aldrich, St. Louis, MO, USA). Single cells were seeded on irradiated human foreskin fibroblasts in NutriStem medium supplemented with SMC4 small-molecule cocktail inhibitors containing PD0325901 (Sigma Aldrich, St. Louis, MO, USA), CHIR99021, Thiazovivin, and SB431542 (STEMCELL Technologies, Vancouver, BC, Canada) [21 (link)]. Emerging single-cell colonies were manually picked up and cultured on Matrigel-coated plates and underwent full iPSC characterization. Clone 5-19H10 (CAR19-NK/iPSC) and its parental cells (WT-NK/iPSC) were used in this study.
+ Open protocol
+ Expand
7

Modulating Developmental Pathways in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
All chemicals were dissolved in E3 medium and administered by immersion from 48 to 74 hpf. Vegf signalling was inhibited using 25 nM tivozanib (AV-951, AVEO Pharmaceuticals); vehicle control groups were exposed to 0.0025% dimethyl sulfoxide (DMSO). mTOR signalling was inhibited using 2-2.5 µM rapamycin (Sigma-Aldrich); vehicle control groups were exposed to 0.2-1% DMSO. MEK signalling was inhibited using 7.5-10 µM PD0325901 (Anastasaki et al., 2012 (link)) (Sigma-Aldrich); vehicle control groups were exposed to 0.75-1% DMSO. p38 MAPK signalling was inhibited by 25 µM SB 203580 (Sigma-Aldrich). Nos inhibition was achieved by incubation with 0.5 mM L-NAME (Sigma-Aldrich) diluted in E3 medium.
+ Open protocol
+ Expand
8

CRC Cell Line Characterization and Drug Screens

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human CRC cell lines used in this study were HCT-116 (CVCL_0291), HT-29 (CVCL_0320) and SW-620 (CVCL_0547). The cell lines were directly obtained from NCI. No mycoplasma testing was done in-house. Cells were routinely cultured in 1X RPMI-1640 medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS, Sigma Aldrich), 2 mM l-Glutamine (Sigma Aldrich) and 100 U/mL Penicillin–Streptomycin (Thermo Fisher Scientific). All cells were maintained at 37 °C with 5% CO2 and 80% relative humidity and passaged according to in-house protocols (see Supplementary Methods). Cells used in experiments never exceeded passage 21.
Drugs used in screens were olaparib (Selleckchem), oxaliplatin (Selleckchem), palbociclib (Selleckchem), PI-103 (Selleckchem), PD0325901 (Sigma Aldrich), 5-fluorouracil (5-FU, Sigma Aldrich) and 5Z-7-Oxozeaenol (Enzo Life Sciences). Assay reagents used in screens were CellTiter-Glo 2.0 Assay (Promega), CellTiter-Glo 3D Cell Viability Assay (Promega), CellTox Green Cytotoxicity Assay17 (Promega) and NucView 488 Caspase-3 Substrate18 (Biotium).
+ Open protocol
+ Expand
9

Murine Macrophage Activation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
BMDMs were prepared from 6-week-old C57BL/6, Myd88−/−, Trif−/−, Irf3−/−, or Ifnar−/− male mice. Fetal liver macrophages were from D14.5 C57BL/6 or RelA−/− embryos. Macrophages were activated on day 6 with 100 ng/ml lipid A (Sigma) or Pam3CSK4 (InvivoGen). When indicated, cells were preincubated for 15 min with 10 mg/ml CHX or 1 hr with 10 μM PD0325901 (Sigma) and 1 μM BIRB0796 (AXON Medchem).
+ Open protocol
+ Expand
10

Blastocyst Development Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Embryos from CD1 (Charles River laboratories, France) intercrosses were recovered at E2.75 and at E3.25 (expanding blastocyst) by flushing oviducts or uteri in M2 (Millipore), washed twice and cultured inside their intact zona pellucida in 400 µL KSOM (Millipore) in Nunc 4-well plates until the stages of interest at 37 °C, 8% CO2. For treatment, we used FGF receptor inhibitor PD173074 (100 nM, Sigma Aldrich), MEK inhibitor PD0325901 (1μM, Sigma Aldrich), flavopiridol (1μM, Selleckchem), MG132 (10 μM, Sigma Aldrich) and FGF4 (1 μg/ml, R&D systems) supplemented with heparin (1 μg/ml, Sigma Aldrich). Experiments shown in Figs 2(A–C) and 3 were performed in parallel using same batches of embryos. All experiments were conducted according to the French and European regulations on care and protection of laboratory animals (EC Directive 86/609, French Law 2001–486 issued on June 6, 2001) and were approved by the Institut Pasteur ethics committee (n° 2012–0011).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!