Truseq dna sample prep kit

Seeds of PP was germinated, and 15-day-old seedlings were used for genomic DNA extraction using Qiagen DNeasy kit (Qiagen). Qubit 2.0 fluorometer (Thermo Fisher) was used to quantify and NanoDrop 2000 (Thermo Fisher) for quality check of the isolated DNA. The DNA was fragmented to 300 bp size using a Covaris M220 focused ultrasonicator. The fragmented DNA was purified, and sequencing libraries were prepared using Illumina TruSeq DNA sample prep kit (Illumina Inc., United States) as per manufacturer’s specifications. The quantity and size distribution of the libraries were carried out using a Bioanalyzer 2100 (Agilent Technologies). The quantified libraries were subjected for whole genome sequencing on Illumina HiSeq-2000 platform (Illumina Technologies) by paired-end sequencing to generate 90-base pair long, small reads with an insert size of 200–350 bp (Supplementary Figure S2). Standard Illumina pipeline was used to filter the whole genome sequencing data. To remove low-quality reads and reads containing adaptor/primer contamination, FASTQ files were further subjected to stringent quality control using NGS QC Toolkit (v2.3) (Patel and Jain, 2012 (link)).

The stool samples from a cross-sectional study were collected in sterile plastic cups as soon as they went to the outpatient clinic. The second sample was collected at home and stored at −20°C. All samples were shipped in dry ice to our laboratory and stored at −80°C until DNA extraction.
DNA was extracted by bead beating on a FastPrep instrument (MP Biomedicals, Santa Ana, California) followed by genomic DNA extraction with a FastDNA kit (MP Biomedicals, Santa Ana, CA, USA). The purity and concentration of the metagenomic DNA was measured using a NanoDrop ND-2000 spectrophotometer, and integrity and size were assessed using 1.0% agarose gel electrophoresis on gels containing 0.5 mg/mL ethidium bromide. The V1-V3 region of the bacterial 16S rRNA gene was amplified using a polymerase chain reaction (PCR) procedure and the barcode primer set 338F ACTCCTACGGGAGGCAGCAG and 806R GGACTACHVGGGTWTCTAAT. The DNA products were purified by gel extraction and quantified using QuantiFluor-ST (Promega, Madison, WI, USA). The purified amplicons were pooled in equimolar concentrations and sequenced using the Illumina MiSeq platform with a TruSeqTM DNA Sample Prep Kit (Illumina, San Diego, CA, USA).

Five libraries including the single species genomic DNA were constructed, namely the individual species library. Approximately 1 Gbp raw data were generated for the individual species library. In addition, seven libraries included multiple species, namely the multiplex sample library. Besides the sequenced leaf beetle species, other 20 distantly related species with equimolar amounts of DNA were pooled into a library, respectively. Approximately 20 Gbp raw data were generated for each of the library including multiple species. For both kinds of libraries, genomic DNA was sonicated to 300 bp using Covaris S220 focused-ultrasonicator (Covaris Inc.), according to Illumina’s protocol. Genomic libraries were constructed using an Illumina TruSeq TM DNA Sample Prep Kit (Illumina, San Diego, CA, USA). Genome sequencing was performed on an Illumina HiSeq 2500 platform (Beijing Novogene Bioinformatics Technology Co., Ltd, China), using 150 bp paired-end run.
The raw reads were demultiplexed and concatenated. The low-quality reads, low-quality ends, and adapter sequences were trimmed using NGS QC Toolkit [45 (link)]. The clean reads were used in the genome assembly. We used IDBA-tran [46 (link)] to conduct the de novo assembly. The parameters are set to the minimum size of contig of 200, an initial k-mer size of 41, an iteration size of 10, and a maximum k-mer size of 91.

Genomic DNA for each sample was pooled into twelve different libraries, respectively. Approximately equimolar amounts of genomic DNA for other insect species (ca. 20 different species) were mixed into the library. Each pool was designed to include distant taxonomic species in order to reduce the risk of a “contamination” and/or reads assignment errors in the following steps. For library preparation, Illumina TruSeqTM DNA Sample Prep Kit (Illumina, San Diego, CA, USA) was employed, with an average insert size of 350 bp. The indexed libraries were directly sequenced on a HiSeq X Ten platform (Beijing Novogene Bioinformatics Technology Co., Ltd, China), with 150 bp pair-ended reads.

Genomic DNA was extracted from the intestinal bacteria using a bacterial DNA isolation kit (Foregene, Chengdu, China) according to the manufacturer’s instructions. The extracted DNA was checked on 1% agarose gel, and DNA concentration and purity were determined with NanoDrop 2000 UV-vis spectrophotometer (Thermo Scientific, Wilmington, DE, USA). After the extraction, DNA fragments from the samples were amplified using specific primers: 338F: 5′-ACTCCTACGGGAGGCAGCAG-3′, 806R: 5′-GGACTACHVGGGTWTCTAAT-3′ [61 (link)]. The PCR product was detected using 2% agarose gel, purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) and quantified using Quantus™ Fluorometer (Promega, Madison, WI, USA). V3–V4 amplicon library was constructed using TruSeqTM DNA Sample Prep Kit (Illumina, San Diego, CA, USA). High-throughput sequencing was performed in a paired-end model using the Illumina MiSeq PE300 platform (Illumina, San Diego, CA, USA) by Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China).

Whole exome sequencing was performed at the Hereditary Research Laboratory, Bethlehem University, using Illumina’s NextSeq^TM 500 Sequencing System. DNA libraries were prepared using two preparation kits: the Illumina^® TruSeq^TM DNA Sample Prep Kit, or Nextera^TM Flex for Enrichment Prep Kit. Following sequencing, reads were aligned to the reference human genome (hg19) using the Burrows-Wheeler (BWA) aligner. Prior to variant calling by the Genome Analysis Toolkit³, mapped reads (BAM format) were re-processed by removing PCR duplicates, realigning around indels, and recalibrating base quality. The final list of variants was annotated by ANNOVAR⁴ (Wang et al., 2010 (link)) using several databases of minor allele frequency including gnomAD⁵ and PopFreqMax, as well as variant effect predictors such as SIFT (Sorting Intolerant from Tolerant⁶), PolyPhen-2⁷ and REVEL (Ioannidis et al., 2016 (link)). Candidate variants were validated by Sanger sequencing and then tested for co-segregation with the phenotype in additional family members.