The largest database of trusted experimental protocols

83 protocols using spironolactone

1

Spironolactone Effects on SBMA Fly Model

Check if the same lab product or an alternative is used in the 5 most similar protocols
To determine whether spironolactone induces a degenerative phenotype in a fly model of SBMA, we determined the viability of transgenic flies that were reared on food containing increasing concentrations of spironolactone (Sigma Aldrich) or 1% ethanol vehicle. Virgin female homozygous Elav > Gal4 flies were mated to male transgenic flies carrying the UAS-hAR52Q transgene and Cyo-GFP second chromosome balancer to produce either Elav > AR52Q (SBMA fly model) or Elav;Cyo-GFP (control) progeny [6 (link)]. Upon the presence of pupae within the mating vial containing spironolactone, parental flies were removed and emerging adult progeny were scored for the presence or absence of the Cyo-GFP phenotypic marker over the course of 10 days.
+ Open protocol
+ Expand
2

Cyclosporine A Nanoemulsion Formulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cyclosporine A (CsA) was obtained from LC Laboratories (Boston, MA, USA) and Compritol 888 ATO (glyceryl behenate) from Gattefossé (Saint-Priest, France). Spironolactone (SPIR), stearic acid and Tween 80 (polysorbate 80) were purchased from Sigma-Aldrich (St. Louis, MO, USA); polyvinylpyrrolidone (PVP) was from BASF (Ludwigshafen, Germany). Methanol and acetonitrile were purchased from Merck (Darmstadt, Germany) and sodium lauryl sulfate (SLS) from POCH (Gliwice, Poland). All other chemicals used were of analytical reagent grade.
+ Open protocol
+ Expand
3

Spironolactone-Loaded PLGA Microspheres

Check if the same lab product or an alternative is used in the 5 most similar protocols
PLGA ratio 50:50 (Resomer®503) was purchased from Boehringer Ingelheim Pharma GmbH & Co. (Ingelheim, Germany). Spironolactone was obtained from Sigma-Aldrich (Schnelldorf, Germany). Polyvinyl alcohol 72,000 g/mol (PVA) was obtained from Merck KGaA (Darmstadt, Germany). All organic solvents were high performance liquid chromatography (HPLC) grade and used as received.
Spironolactone-loaded and non-loaded PLGA MSs were elaborated using an oil-in-water (O/W) emulsion solvent evaporation technique35 (link). Briefly, The O-phase was prepared by suspension of 40 mg of Spironolactone in 1 ml of PLGA solution in methylene chloride (20% w/v) resulting in a Spiro:PLGA ratio of 2:10. This phase was emulsified with the W-phase composed by 5 ml of PVA MilliQ® water solution (2% w/v). The emulsification was performed at 5,000 rpm for 1 min (Polytron® RECO, Kinematica GmbH PT 10–35, Lucerna, Switzerland). This O/W emulsion was subsequently poured onto 100 ml of an aqueous PVA solution (0.1%) and maintained under constant stirring for 3 h to allow MSs hardening. After that, the MSs were washed, filtered, freeze-dried, and kept at −20 °C under dry conditions until used.
+ Open protocol
+ Expand
4

Dissecting Metabolic Pathways through Pharmacological Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
CL316243, forskolin, 8Br-cAMP, ARL 67156 trisodium salt, and suramin were procured from Tocris (Minneapolis, MN). Carbenoxolone, trovofloxacin, and spironolactone were from Sigma Aldrich (St. Louis, MO). Silencer select siRNAs against mouse Panx1 (assay ID-s79985) or mouse Gβ subunits (GNB1 – assay ID –ss66813; GNB2 – assay ID –ss66816; GNB3 – assay ID –ss66822; GNB4 – assay ID –n420113) and silencer select negative control-2 siRNA (4390846) were purchased from ThermoFisher Scientific (Middletown, VA). Antibodies used in the study were as follows: mouse monoclonal anti-Panx1 (Clone 720505, #MAB7097) was from R&D Systems (Minneapolis, MN); rabbit-polyclonal anti-UCP1 (#U6382) was from Sigma–Aldrich (St. Louis, MO); mouse monoclonal OXPHOS antibody cocktail (#MS604) was from Mitosciences (Eugene, OR); rabbit monoclonal anti-Panx1 antibody (Clone D9M1C, #91137), anti-PKC phosphorylation antibody sampler kit (#9921) and rabbit monoclonal anti-vinculin (Clone E1E9 V, #13901) were from Cell Signaling (Danver, MA). Cellular glucose uptake was measured using a glucose uptake-Glo assay kit (#J1341, Promega, Madison, WI).
+ Open protocol
+ Expand
5

Corticosterone and Antagonist Effects

Check if the same lab product or an alternative is used in the 5 most similar protocols
Male C57BL/6J mice were single housed 4 days prior to the experiment and their daily water intake was monitored. On the experimental day, mice were treated overnight (14 h) with either CORT (0.1 mg/ml in drinking water resulting in a ~25 mg/kg average dose based on the initially determined fluid intake; 4-pregnen-11β 21-DIOL-3 20-DIONE 21-hemisuccinate, #Q1562-000, Steraloids), RU486 (0.05 mg/ml in 0.5% EtOH resulting in a ~10 mg/kg average dose based on the initially determined fluid intake; Mifepristone, #475838, Sigma-Aldrich) or Spironolactone (0.124 mg/ml in 0.4% EtOH resulting in a ~20 mg/kg average dose based on the initially determined fluid intake; #S3378, Sigma-Aldrich). Control animals received their respective vehicle solutions. The next morning all mice were sacrificed by decapitation following quick anesthesia by isoflurane. Brains were removed, snap-frozen in isopentane at −40°C, and stored at −80°C until further processing. Overnight fluid intake did not differ between treatment groups.
+ Open protocol
+ Expand
6

Aldosterone Signaling Pathways in Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
THP-1 and RAW 264.7 cells (106/ml) were pretreated with the indicated inhibitors 1 hour prior to aldosterone (10−6 M) treatment. After 24 hours, the cell culture supernatants were collected for galectin-3 detection by EIA. The inhibitors were PD98059 (Sigma, St. Louis, MO, USA; ERK inhibitor), LY294002 (Sigma, St. Louis, MO, USA; phosphoinositide 3-kinase inhibitor), SB203580 (Sigma, St. Louis, MO, USA; p38 inhibitor), Ro318220 Sigma, St. Louis, MO, USA; protein kinase C inhibitor), and SP600125 (Sigma, St. Louis, MO, USA; Jun N-terminal kinase inhibitor).
For nuclear factor (NF)-κB pathway analysis, THP-1 and RAW-264.7 cells were serum-starved for 24 hours and then pre-treated with 10−7 M of spironolactone, LY294002 or BAY117082 (Sigma, St. Louis, MO, USA; NF-κB inhibitors) for 1 hour before 10−6 M aldosterone treatment. Nuclear and cytosolic proteins were collected after 1 hour, and the level of the NF-κB p65 subunit was determined by Western blotting.
+ Open protocol
+ Expand
7

Quantifying ATP Release and Dye Uptake in Bone Marrow-Derived Neutrophils

Check if the same lab product or an alternative is used in the 5 most similar protocols
For ATP release assay, BMDNs were left to equilibrate in Tyrode’s buffer (124 mM NaCl, 2.4 mM KCl, 10.8 mM NaHCO3, 0.4 mM NaH2PO4*H2O, 0.9 mM MgCl2*6H2O, 1.8 mM CaCl2*6H2O, pH 7.35). Panx1 channel mediated ATP release was activated by reducing osmolarity of the Tyrode’s buffer by decreasing NaCl to 30.24 mM. WT and Panx1−/− BMDNs were stimulated with appropriate controls for 5 min. Cells were centrifuged at 1200 rpm for 5 minutes and supernatants were collected for ATP measurement using the ATP bioluminescent assay kit (#FLAA, Sigma Aldrich), according to the manufacturer’s instructions.
For dye uptake assay, BMDNs were seeded in 384-well plate and maintained in a physiological solution (136 mM NaCl, 4 mM KCl, 1 mM CaCl2, 1 mM MgCl2, and 2.5 mM glucose, buffered to pH 7.4 with 10 mM HEPES-NaOH solution). YO-PRO-1 Iodide (5 µM, ThermoFisher Scientific, #Y3603) was added to equilibrate cells. Hypo-osmotic shock was induced to maximally open Panx1 channels. Inhibitors of Panx1 BB-FCF dye-Erioglaucine disodium salt (Sigma Aldrich, #80717)24 (link),25 (link) and spironolactone (Sigma Aldrich, #S3378)39 (link) were prepared in DMSO and used at 1μM and 100 μM, respectively. Global quantification of YO-PRO-1 dye uptake per well was performed using the FDSS/µCELL Functional Drug Screening System (Hamamatsu Photonics).
+ Open protocol
+ Expand
8

Mdx Mice Treatment with Spironolactone and Prednisolone

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mdx mice were treated using water bottles containing 250 mg/L spironolactone (Sigma-Aldrich, S3378) or 6.7 mg/L prednisolone (Sigma-Aldrich, P6004), the active metabolite of prednisone dissolved in MediDrop containing sucralose (ClearH2O, 75-01-1001). Mice were treated during the peak of inflammation for 10 days for cytokine- and chemokine-level analysis to allow detection of differences in protein expression (4–5.5 weeks of age), for 7 days (3.5–4.5 weeks of age) for flow cytometry, RNA-Seq, and diaphragm IHC or for 14 days (3.5–5.5 weeks of age) for quadriceps IHC and histology. Approximate dosages for spironolactone and prednisolone treatment were 37.5 and 1 mg/kg × day, respectively (8 (link), 33 (link)). The mdx mice given MediDrop vehicle were used as controls for all experiments. Mice were housed 5 per cage and euthanized via cervical dislocation.
+ Open protocol
+ Expand
9

Spironolactone Dosing in Rats

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dosing for these animals was calculated using the Food and Drug Administration's 2005 allometric scaling calculations as described by Reagon‐Shaw et al. (2008). To deliver a human equivalent dose of 50 mg/day of spironolactone (Sigma‐Aldrich), 4.41 mg kg day−1 was administered to each rat. Experimental animals were dosed orally each day from 10 weeks of age (Day 1), and to enhance acceptance, spironolactone was mixed into a caramel syrup (Quaterpast, Shott Beverages Ltd.).
+ Open protocol
+ Expand
10

Immortalized Mouse Embryonic Fibroblast Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
SV40-LT-immortalized Trf1F/F and BlmF/F MEFs were described previously (Chester et al. 1998 (link); Sfeir et al. 2009 (link); Wu et al. 2012 (link)). MEFs were cultured in DMEM (Cellgro) supplemented with 100 U/mL penicillin (Gibco), 100 μg/mL streptomycin (Gibco), 0.2 mM L-glutamine (Gibco), 0.1 mM nonessential amino acids (Gibco), and 10% bovine calf serum (HyClone). Cre recombinase was introduced by two retroviral infections with Hit&Run Cre in pMMP at 12-h intervals. Adeno-GFP (Vector Biolabs 1060) and Adeno-Cre (Vector Biolabs 1700) were used as indicated in experiments that used Adeno-Cas9. In all experiments involving Cre or Cas9, cells were harvested 120 h after the initial introduction of the virus. Mouse Trf1 cDNA and the mutants were cloned into the pLPC-Myc-Puro or the pWZL-FLAG-Hygro vectors. MEFs infected with retroviral vectors were selected with 2.5 μg/mL puromycin or 135 μg/mL hygromycin for 3 d. shPold3 (TRCN0000279480) and a control shLuc (CGCTGAGTACTTCGAAATGTC) were cloned into the pLKO.1 vector. Spironolactone was purchased from Sigma (S3378), and CDK7i YKL-5-124 was from SelleckChem (S8863).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!