The largest database of trusted experimental protocols

42 protocols using cycloheximide (chx)

1

PRDM1 Protein Stability Assay in HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells were transfected with wild or mutant pEGFP-C1-PRDM1 overexpression plasmids. pEGFP-C1 vector was also transfected as the negative control group. At 48 hours after transfection, cells were harvested and lysed in RIPA lysis buffer (Beyotime) with 1% Protease Inhibitor Cocktail (Cell Signaling Technology). The total protein was quantitated using a BCA protein assay kit (Thermo Fisher Scientific) according to the manufacturerʼs instructions. Total protein (20 μg) of each sample was loaded, separated on an SDS–PAGE gel and transferred to a polyvinylidene fluoride membrane (MilliporeSigma). The membrane was blocked, incubated with GFP antibody (1:10,000 dilution, Abcam) and anti-rabbit secondary antibodies (1:5,000 dilution, Proteintech) and with β-actin antibody (1:5,000 dilution, Proteintech) and anti-mouse secondary antibody (1:5,000 dilution, Proteintech). The membranes were scanned using a Chemidoc MP Imaging System (Bio-Rad). Two independent experiments were carried out.
For the CHX chase assay, CHX (Beyotime) was added to the culture medium 24 hours after transfection at a concentration of 0.01 mM. Upon treating with CHX for 0 hours, 4 hours, 8 hours and 12 hours, cell samples were collected and stored at −80 °C until western blot analysis was performed. For each timepoint, three independent experiments were carried out.
+ Open protocol
+ Expand
2

Signaling Pathway Antibody Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies for PAK1, phospho-PAK1 and phospho-Ser/Thr were from Cell Signaling Technology; IFT88, KIF3A, SuFu, c-Myc, Gli1, acetylated-αTubulin (Ac-Tub), Vav2, GAPDH and β-actin antibdies were from Santa Cruz Biotechnology; Ptch1 antibody, Smo antibody and phospho-Vav2 antibody were from Abcam; Gli2 antibody and Rac1 antibody were from Bioss (Beijing, China); Rac2 and Rac3 antibodies were purchased from Huabio (Hangzhou, China); Flag-tag and HA-tag antibodies were from Beyotime (Shanghai, China); GST-tag antibody was from Yeason (Shanghai, China), and antibody anti-Arl13b was from Proteintech. Alexa555- and Alexa-488 conjugated secondary antibodies were from Life Technology. Recombinant mouse Shh protein (N-Shh, C25II, N-Terminus) was from R&D Systems (#464-SH). Cyclopamine, SAG and NSC23766 were purchased from Selleckchem. Cycloheximide and MG132 were from Beyotime (Shanghai, China).
+ Open protocol
+ Expand
3

Cycloheximide-induced Protein Changes

Check if the same lab product or an alternative is used in the 5 most similar protocols
S26-LMP1 and S26-LMP1/2A cells were exposed to 100 μM cycloheximide (Beyotime, Cat#SC0353) for indicated hours, and Western blotting was performed to detect the proteins of interest.
+ Open protocol
+ Expand
4

RhoA Activation Assay and Immunoblotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cycloheximide was purchased from Beyotime Biotechnology (Hangzhou, China). MG132 was purchased from Sigma-Aldrich (USA). Rhodamine phalloidin was purchased from Cytoskeleton (USA). A G-LISA RhoA Activation Assay Biochem Kit was purchased from Cytoskeleton. Antibodies against AAMP (used for western blot [WB]) and RhoA (used for WB and IHC staining) were purchased from Acbam. Antibodies against β-actin, p-ERM, N-cadherin, E-cadherin, Snail, Ubiquitin, NEDD4, NEDD4L, and SMURF2 were obtained from Cell Signal Technology. Antibody against AAMP (used for IHC staining) was obtained from GeneTex. Antibody against RhoA (used for IP) was purchased from Santa Cruz Biotechnology.
+ Open protocol
+ Expand
5

Investigating Signaling Pathways in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Gefitinib, tucatinib and MG132 were obtained from MedChemExpress (HY-50895, HY-16069 and HY-13259). Actinomycin D was obtained from Amresco (J608). SP600125 and human EGF were purchased from Sigma-Aldrich (S5567 and E9644). PD153035 was purchased from Selleck (S6546). Cycloheximide was obtained from Beyotime (S1560).
The antibodies against human c-Jun, PARP-1, phosphorylated ERK1/2 (Thr202/Tyr204), phosphorylated mTOR (Ser2448), TSC1, JNK and phosphorylated JNK were from Cell Signaling Technology (9165, 9532, 4370, 5536, 6935, 9252 and 4668). The anti-CNOT3 antibody was purchased from Proteintech (11135-1-AP). The antibodies against phosphorylated c-Jun (S73), ki67 and ubiquitin were from Abcam (ab30620, Ab16667 and ab134953). The antibodies against ERK1/2 were purchased from Abcam (ab54230) and Cell Signaling Technology (4695). The antibody against mTOR was purchased from Santa Cruz Biotechnology (sc-517464). The antibody against Keratin 7 was obtained from ZSGB-BIO (ZM-0071).
+ Open protocol
+ Expand
6

Isolation of ribosome-nascent chain complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The method of ribosome-nascent chain complex (RNC) isolation was generated as described before (Wang et al., 2013 (link)). In brief, MHCC97H cells were pre-treated with 100 μg/ml cycloheximide (Acmec, Shanghai, China) for 10 min at 37°C, followed by 5 ml pre-colded PBS (Beyotime, Shanghai, China) washes twice and lysis for 30 min on ice by 2 ml pre-cooled human cell lysis buffer (20 mM Tris-HCl, 5 mM MgCl2, 150 mM KCl, 1 mM DTT, 100 μg/ml cycloheximide, 25 units/mL Turbo DNase I, 1% Triton X-100). Cell lysates were clarified by centrifuge at 17000 × g at 4°C for 15 min, supernatants were transferred on the surface of 14.5 ml sucrose cushion (30% sucrose, 20 mM Tris-HCl, 5 mM MgCl2, 150 mM KCl, 1 mM DTT, 100 μg/ml cycloheximide). RNCs were purified by ultra-centrifugation in a Type 70Ti rotor (Beckman Coulter, Brea, CA, United States) at 185,000 × g for 5 h at 4°C.
+ Open protocol
+ Expand
7

Molecular Regulation of Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
CLB (Sigma-Aldrich, C5423); H-89 (Beyotime, S1643); cycloheximide (Beyotime, S1560); β2-AR siRNA (Santa Cruz, sc-39867); β-arrestin 1 shRNA (Origene, TG510701); β-arrestin 2 shRNA (Origene, TF517061). p27 siRNA (si-P, si-8, and si-10) and control siRNA (siNC) were synthesized by Shanghai Genepharma Co., Ltd. with the following respective sequences: 5' ACGTAAACAGCTCCGAATTAA 3', 5' GGUGCCUUUAAUUGGGUCUTT 3', 5' GGCCAACAGAACAGAAGAATT 3', 5' UUCUCCGAACGUGUCACGUTT 3'.
+ Open protocol
+ Expand
8

Protein Synthesis Inhibition and FTO Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
HUVECs were treated with 10 μM cycloheximide (Beyotime Biotechnology) for various durations (0, 2, 4, and 6 h) to block protein synthesis. To inhibit the proteasome or lysosome before harvesting, 20 μM MG132 (Beyotime Biotechnology) or 0.1 μM bafilomycin A1 (MedChem Express) was also administered. The protein expression of FTO was determined via Western blotting.
+ Open protocol
+ Expand
9

TGF-β Signaling and MMP Inhibition in EMT

Check if the same lab product or an alternative is used in the 5 most similar protocols
TGF-β was purchased from PeproTech (Rocky Hill, NJ, USA). The p38MAPK inhibitor SB203580 and MMP inhibitor BB-94 were from MedChemExpress (NJ, USA). The proteasome inhibitor MG132 was from Merk-Millipore (Darmstadt, Germany). Cycloheximide was from Beyotime Biotechnology (Shanghai, China). The antibodies used were as follows: anti-Twist1, anti-FLAG, anti-phosphorylated MKK3 (S189) and anti-phosphorylated MKK6 (S207) (Abcam, Cambridge, UK); anti-SNCG and anti-β-actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA); anti-Erk1/2, anti-phosphorylated Erk1/2 (T202/Y204) and anti-phosphorylated p38MAPK (T180/Y182) (Cell Signaling Technology, Beverly, MA, USA); anti-p38α and anti-vimentin (Proteintech, Rosemont, IL, USA); anti-MMP-9, anti-SMAD3, anti-MKK3/6, anti-fibronection, anti-N-cadherin (Abways Technology, Shanghai, China). The pcDNA3-Twist1 and PCI-SNCG plasmids were prepared as described previously 12 (link), 20 (link).
+ Open protocol
+ Expand
10

Murine Cell Line Cultivation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The murine myeloma cell line SP2/0, monocyte/macrophage cell line Raw246.7, CHO cell line and IL-2/IL-15 dependent cell line CTLL-2 were purchased from Chinese Academy of Sciences Shanghai Institute of Cell Resource Center) (Shanghai, China). Cells were maintained in complete RPMI media. Recombinant human (rh) IL-15 was purchased from Xiamen Special Treasure Biological Engineering (Xiamen, China). Cycloheximide was purchased from Beyotime Biotechnology (Shanghai, China). LPS was obtained from Sigma-Aldrich Co. (St. Louis, MO). Polyclonal anti-IL-15 antibody was purchased from ABcam (Cambridge, MA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!