DNA isolated from mouse lung tissues (100 ng) was treated with bisulfite using an EpiTect Bisulfite Kit (Qiagen, Frederick MD) according to the manufacturer’s instructions. DNA was amplified by PCR with primers for the following genes: Ahrr, DAPK1, CDH13, Tet1, and Rassf1. Bisulfite converted DNA was prepared for pyrosequencing according to the instructions in the PyroMark assay kit (Qiagen, Frederick, MD). Pyrosequencing was carried out according to the design files from Qiagen and the Qiagen PyroMark Assay Design SW 2.0 on the PyroMark Q96 (Qiagen, https://www.qiagen.com/us/products/discovery-and-translational-research/epigenetics/dna-methylation/pyrosequencing/software/pyromark-supplementary-software/ ). Primer sequences and experimental details are given in the Supplementary Methods.
Pyromark assay kit
Manufactured by Qiagen
Sourced in United States
The PyroMark assay kit is a molecular biology tool designed for the analysis of DNA sequences. It enables the detection and quantification of specific DNA modifications or single nucleotide polymorphisms (SNPs) through a real-time pyrosequencing method. The kit includes the necessary reagents and consumables to perform the pyrosequencing analysis.
Automatically generated - may contain errors
2 protocols using pyromark assay kit
1
Bisulfite Sequencing of Epigenetic Markers
2
LINE-1 CpG Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from mouse samples and evaluated for the status of methylation in CpG dinucleotides located in the L1 region. The 5′UTR region upstream of ORF1 in the LINE-1 element was PCR amplified and analyzed for DNA methylation using the Qiagen PyroMark assay kit (Qiagen, USA) [20 ]. The primer sets (5′-biotin-labeled) used for PCR amplification were: Fwd: CCAGCTGGGGAGGCGGCCTA, Rev: CTGGTAATCTCTGGAGTT and the sequencing probe used was: GCCACAGCAGCAG. Briefly, the PCR products were suspended using the PyroMark Q24 kit (Qiagen) following the manufacturer’s protocol, and the methylation status was quantified with an estimated score of 0–100, with 0 being no methylation and 100 representing complete methylation for all of the CpG dinucleotides in the region. The threshold in the assay was >5%.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!