Genomic DNA was extracted using GenCatch Genomic DNA Extraction Kits from Epoch Life Science (Sugar Land, TX, USA). Mitochondrial markers were PCR-amplified using primers listed in S2 Table . PCR reactions (25 μl) contained 1 ul of template DNA, 0.75 μl of each primer (10 mM), 0.75 μl of dNTP’s (10 mM; Kapa Biosystems, Wilmington, MA, USA), 0.5 μl of HIFI DNA Polymerase (Kapa Biosystems), 5 μl of 5x PCR buffer (Kapa Biosystems) and molecular grade DI water up to 25 μl. PCR conditions consisted of an initial denaturation step at 94°C for 2min, followed by 30 cycles of 30s at 94°C, 30s at 56–63°C, and 60s at 72°C, and a final 5 min extension step at 72°C. PCR products were visualized on 1% agarose gels. Successful PCR amplifications were sent off to Epoch Life Science (Missouri City, TX, USA) for sequencing in both directions. Sequence data were visualized and edited in Geneious Prime 2020.1.2 (Biomatters Limited, Auckland, New Zealand) to generate consensus sequence per sample per locus. New sequences were deposited on GenBank under the accession codes listed in S1 Table . Additional sequences were obtained from [61 (link)]) and the NCBI GeneBank, as described above and listed in S1 Table .
Dntps
Manufactured by Roche
Sourced in United States, Germany, United Kingdom, Switzerland, Australia
DNTPs (Deoxynucleotide Triphosphates) are fundamental building blocks for DNA synthesis. They provide the necessary nucleotides for DNA polymerases to replicate and amplify DNA sequences during various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Transcriptor reverse transcriptase, by Roche (11 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (8 mentions)
Mgcl2, by Roche (7 mentions)
Rnaseout, by Thermo Fisher Scientific (6 mentions)
Random hexamer, by Thermo Fisher Scientific (6 mentions)
Tripure, by Roche (5 mentions)
Protector rnase inhibitor, by Roche (5 mentions)
Oligo dt primer, by Promega (4 mentions)
M mlv rt buffer, by Promega (4 mentions)
M mlv reverse transcriptase, by Promega (4 mentions)
Taq polymerase, by Roche (4 mentions)
Random primer, by Promega (4 mentions)
High pure rna tissue kit, by Roche (3 mentions)
Lightcycler 480, by Toyobo (3 mentions)
Sybr green mix, by Toyobo (3 mentions)
Faststart taq dna polymerase, by Roche (3 mentions)
First strand buffer, by Thermo Fisher Scientific (3 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (3 mentions)
T4 polynucleotide kinase, by New England Biolabs (3 mentions)
γ 32p atp, by MP Biomedicals (3 mentions)
85 protocols using dntps
1
Mitochondrial DNA Extraction and Sequencing
2
RNA Extraction and qRT-PCR Analysis of MEF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of RNA from MEF was performed with the GenElute Mammalian Total RNA Miniprep Kit (Sigma) according to the manufacturer’s instructions. One microgram of RNA was used for cDNA synthesis with dNTPs (Kapa Biosystems), oligo(dT) and the SuperScript II reverse transcriptase (Thermo Fisher Scientific) according to the instructions of the manufacturer. For each qRT-PCR reaction, 10 μl of Power SYBR Green PCR Master Mix (Bimake), 0.4 μl of reference ROX dye and 7.6 μl of milliQ sterile water were added to 1 μl cDNA together with 1 μl of 10 μM forward and reverse primer mix (mTMX4 (I) fwd: (5’−3’): TTG AGT GGC CGC TTC TTT GT rev: (5’−3’): CCA GAC ATC GTT AGA GAG GCT; mTMX4 (II) fwd: (5’−3’): CAT CCT GCC AGC AGA CTG ATT rev: (5’−3’): GGC GGA ATA TCC CAT CTT TTG C), (mBiP fwd: (5’−3’): GAGTTCTTCAATGGCAAGGA rev: (5’−3’): CCAGTCAGATCAAATGTACCC) for the transcript of interest in 96-well reaction plate (MicroAmp Fast Optical 96-Well Reaction Plate with Barcode (0.1 ml), Applied Biosystems). The plate was vortexed and centrifuged. Samples were loaded as triplicates. Quantitative real-time PCR was performed using QuantStudio™ 3 Real-Time PCR System. The housekeeping gene actin was used as reference. Data were analyzed using the QuantStudio™ Design & Analysis Software v1.5.5.
3
Optimized Cell Culture Techniques for Bone Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trypan blue, crystal violet, antibiotic-solution containing: streptomycin, fungizone and penicillin, and primary antibodies for western blotting were purchased from Sigma-Aldrich (St Louis, MO, USA).
Dulbecco's minimum essential medium (DMEM) was provided by Sterilab Services (Harrogate, UK) and foetal bovine serum (FBS) was supplied by Biochrom (Berlin, Germany). RANKL was acquired from Research and Diagnostic Systems (R&D Systems, Minneapolis, MN, USA). Cell cluster plates and glass cover slips were purchased from LASEC (Cape Town, South Africa (SA)). Osteoassay plates were purchased from Corning inc. (Corning, NY, USA). Fermented rooibos tea (red rooibos) was obtained from National Brands Limited (Rivonia, Durban, SA). Unfermented rooibos tea (green rooibos) was obtained from Biedouw Valley (Clanwilliam, Western Cape, SA). Phalloidin-conjugate and Hoechst 3342 were purchased from Life Technologies (Carlsbad, CA, USA). IκB and GAPDH rabbit polyclonal antibodies were purchased from Abcam (Cambridge, MA, USA). Secondary antibodies for western blotting were purchased from Bio-Rad (Hercules, CA, USA). Reverse transcriptase was purchased from New England Biolabs (Ipswich, MA, USA). Oligo (dT) primers were purchased through Thermo Scientific (Waltham, MA, USA). Other PCR reagents (dNTPs, DNA polymerase, DNA ladder, loading dye, etc.) were supplied by KAPA Biosystems (Cape Town, SA).
Dulbecco's minimum essential medium (DMEM) was provided by Sterilab Services (Harrogate, UK) and foetal bovine serum (FBS) was supplied by Biochrom (Berlin, Germany). RANKL was acquired from Research and Diagnostic Systems (R&D Systems, Minneapolis, MN, USA). Cell cluster plates and glass cover slips were purchased from LASEC (Cape Town, South Africa (SA)). Osteoassay plates were purchased from Corning inc. (Corning, NY, USA). Fermented rooibos tea (red rooibos) was obtained from National Brands Limited (Rivonia, Durban, SA). Unfermented rooibos tea (green rooibos) was obtained from Biedouw Valley (Clanwilliam, Western Cape, SA). Phalloidin-conjugate and Hoechst 3342 were purchased from Life Technologies (Carlsbad, CA, USA). IκB and GAPDH rabbit polyclonal antibodies were purchased from Abcam (Cambridge, MA, USA). Secondary antibodies for western blotting were purchased from Bio-Rad (Hercules, CA, USA). Reverse transcriptase was purchased from New England Biolabs (Ipswich, MA, USA). Oligo (dT) primers were purchased through Thermo Scientific (Waltham, MA, USA). Other PCR reagents (dNTPs, DNA polymerase, DNA ladder, loading dye, etc.) were supplied by KAPA Biosystems (Cape Town, SA).
4
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted as described above. RNA purity and concentration were evaluated with an ND-1000 NanoDrop spectrophotometer (Thermo Fisher Scientific). qRT-PCR assays were performed in technical triplicate for three biological replicates at the Plateforme Rnomique de l’Université de Sherbrooke (Sherbrooke, QC, Canada). RNA integrity was verified using a 2100 Bioanalyzer instrument (Agilent Technologies). cDNA was prepared from 1.2 μg of total RNA using 10 units of Transcriptor reverse transcriptase (Roche), 0.08 A260 units of random hexamers (IDT), dNTPs (Roche) and 10 units of RNaseOUT (Invitrogen Life Technologies) according to the manufacturer's recommendations in a total volume of 20 μl. Quantitative amplification of acaD and sgaD was carried out as described above with primer pairs acaDFqpCR/acaDR/qPCR and sgaDFqPCR/sgaDRqPCR, respectively. The stably expressed chromosomal gene rpoZ was amplified with primer pair rpoZMG1655F/rpoZMG1655R. Relative expression levels were calculated using the qBase framework (62 (link)) and rpoZ as the reference.
5
Cloning and Plasmid Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA was prepared using the ZR Plasmid Miniprep-Classic Kit (Zymo Research Corp, Irvine, CA, USA). Competent E. coli NEB 10-β cells (New England Biolabs, Herts, United Kingdom) were used for all cloning steps. Restriction enzymes were supplied from New England Biolabs (Herts, United Kingdom). T4 ligase was from Agilent (Santa Clara, CA, USA), and thermostable DNA polymerase iProof™ High-Fidelity was purchased from BioRad (Hercules, CA, USA). dNTPs were from Roche Diagnostics GmbH (Mannheim, Germany). PCR reactions were performed in a FlexCycler2 (Analytik Jena AG, Jena, Germany) using the appropriate cycling conditions. PCR products were purified using the DNA Clean & Concentrator-5 Kit from Zymo Research Corp (Irvine, CA, USA). Accuracy of genetic constructs was verified by sequencing (Microsynth AG, Balgach, Switzerland).
6
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Lipid tissue extraction kit (Qiagen, Hilden, Germany) was utilized to extract RNA from dissected tissues. DNaseI treatment was performed to remove traces of genomic DNA contamination. Concentration of extracted RNA was assessed using a NanoDrop ND-1000 UV-VIS Specro-photometer. Quality of the extracted RNA to be used in the microarray hybridizations was further assessed using the Agilent 2100 Bioanalyzer. In case of cDNA synthesis, equal quantities of RNA were used as template. Synthesis of cDNA was performed using the Superscript III reverse transcriptase kit (Invitrogen, Carlsbad, USA), and random hexamer primers (Invitrogen) and dNTPs (Roche, Basel, Switzerland), following the manufacturer’s protocol.
7
Genotyping Knockout Mouse Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All knock-out mice used in experiments or as donors for adoptive transfers were genotyped at 3–4 weeks of age. At this time, all mice were ear-tagged (National Band & Tag, Newport, KY) and 3–5 millimeter tail snips were collected for genotyping. DNA was extracted using a Qiagen DNeasy DNA extraction kit (Valencia, CA) per manufacturer's protocol. The resulting DNA was used in PCR reactions to determine each individual mouse's genotype. Each reaction contained 0.2 μl FastStart Taq (5 U/μl) (Roche, Indianapolis, IN), 0.3 μl of each 25 μM primer (IDT Coralville, IA), 3.2 μl of 1.25 mM dNTPs (Roche) and 2 μl 10× PCR buffer with MgCl2 (Roche). Thermal cycling conditions were: 1 cycle at 94°C for 4 min, 45 cycles of 15 at 94°C, 45 sec at the appropriate annealing temperature (Table 1 ), 1 min at 72°C and 1 cycle at 72°C for 10 min. PCR reactions were analyzed by gel electrophoresis with 3% 1× TBE agarose gels and amplicons were visualized with ethidium bromide (Bio-rad Hercules, CA). Primer sequences and annealing temperatures are listed in Table 1 .
8
RNA Extraction and mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA extraction, mice were sacrificed in a CO2 chamber. Their DRGs, spinal cord and brain were dissected and snap-frozen in liquid nitrogen, followed by storage at -80oC. On the day of extraction, tissue was mechanically homogenized in Tripure (Roche), treated with chloroform and then subjected to column purification, using a High Pure RNA Tissue kit (Roche). RNA was the eluted in RNAse-free water. cDNA was produced using Transcriptor reverse transcriptase (Roche), random hexamers (Invitrogen) and dNTPs (Roche).
mRNA expression of NCX3 was achieved using SYBR green. DRG, spinal cord and brain cDNA (5ng) and primers (0.5mM) were added to LightCycler 480 SYBR Green Master mix (Roche) in a 1:1 ratio. 384 well plates (Roche) were then run on a 45 cycle protocol as described by. Primer efficiency and specificity were validated before experimental use. Gene expression was validated against GAPDH as a housekeeping gene, using the delta CT method. Primer sequences are as follows (Michel et al., 2014 (link)): NCX3-AC_F – GGGCCCCCGCATGGTGGATA, NCX3-AC_R – CAGCTTCCTGTCTGTCACTTCTGGA, NCX3-B_F - GCATATGGGGAGCTGGAGT, NCX3-B_R – GTTCACCAAGGGCAATGAAG.
mRNA expression of NCX3 was achieved using SYBR green. DRG, spinal cord and brain cDNA (5ng) and primers (0.5mM) were added to LightCycler 480 SYBR Green Master mix (Roche) in a 1:1 ratio. 384 well plates (Roche) were then run on a 45 cycle protocol as described by. Primer efficiency and specificity were validated before experimental use. Gene expression was validated against GAPDH as a housekeeping gene, using the delta CT method. Primer sequences are as follows (Michel et al., 2014 (link)): NCX3-AC_F – GGGCCCCCGCATGGTGGATA, NCX3-AC_R – CAGCTTCCTGTCTGTCACTTCTGGA, NCX3-B_F - GCATATGGGGAGCTGGAGT, NCX3-B_R – GTTCACCAAGGGCAATGAAG.
9
Selective Whole Genome Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Thirty to 70 ng of input DNA was added to a 50-µl reaction mixture containing 3.5 µM SWGA primers, 30 U phi29 DNA polymerase enzyme (New England Biolabs), 1× phi29 buffer (New England Biolabs), 4 mM dNTPs (Roche), 1% bovine serum albumin, and water. The reaction was carried out on a thermocycler with cycling conditions consisting of a ramp down from 35°C to 30°C (10 min per degree), 16 h at 30°C, 10 min at 65°C, and hold at 4°C. The samples were diluted 1:1 with DNase-free, RNase-free water and purified with AMPure XP beads (Beckman-Coulter) at a 1:1 ratio according to the manufacturer’s protocol. When a second round of selective amplification was performed, the reaction mixture contained 100 to 200 ng of the AMPure XP-purified product from the first reaction.
10
Procedure for lft2 antisense probe synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The template for lft2 antisense probe was generated by PCR amplification of cDNA from 12 hours post fertilization wild-type zebrafish, using the following primers: SP6-lft2-F 5′-GATTTAGGTGACACTATAGgaccacagcgatctcactca-3′ and T7-lft2-R 5′-TAATACGACTCACTATAGGGgactggagggattttgtcc-3′. The PCR product was gel extracted and purified by ethanol precipitation. 1.5 μg of template DNA was transcribed using T7 RNA polymerase (Promega, #P207B) in the presence of digoxygenin (DIG)-labelled dNTPs (Roche, #12430721). Probes were purified using G-50 micro-columns (GE Healthcare, #28-9034-08). Embryos were permeabilized with 1% H2O2, equilibrated with hybridization buffer (50% Formamide, 1.3 × SSC pH 5.0, 5 mM EDTA pH 8.0, 200 μg ml−1 Baker’s yeast tRNA, 0.2% Tween-20, 0.5% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 100 μg ml−1 Heparin) and incubated overnight with lft2 DIG-labelled probes. Embryos were blocked with 20% sheep serum+2% Boehringer Blocking Reagent (Roche, #11096176001). Probes were detected with an anti-DIG-alkaline phosphatase antibody (Roche, #11093274910) and the signal was developed using 30 μg ml−1 of each nitro-blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (Roche, #11383213001/#11383221001).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!