Rneasy kit

Total RNA was isolated from frozen DRG tissues using the RNeasy Kit (Invitrogen, Thermo Fisher Scientific, Grand Island, NY, United States), and cDNA was synthesized using iScript cDNA Synthesis Kit (1708890, BIO-RAD, Hercules, CA, United States). qPCR was performed using the iTaq Universal SYBR Green Supermix (1725124, BIO-RAD, CA) with template cDNA and primers for each gene in a BIO-RAD CFX96 real-time PCR system. The relative mRNA expression levels were calculated by the ΔΔCt method and the results were normalized to β-actin levels. The primer sequences are listed as below.
Il-6: F-CCAAGAGGTGAGTGCTTCCC, R-CTGTTGTTCA GACTCTCTCCCT;
Il-1β: F-GCAACTGTTCCTGAACTCAACT, R-ATCTT TTGGGGTCCGTCAACT;
Ccl3: F-TTCTCTGTACCATGACACTCTGC, R-CGTGG AATCTTCCGGCTGTAG;
Cxcl1: F-CTGGGATTCACCTCAAGAACATC, R-CAGGG TCAAGGCAAGCCTC;
β-actin: F- GCAGGAGTACGATGAGTCCG, R-ACGCAGC TCAGTAACAGTCC.

Total RNA was isolated from the salivary glands of wild or klotho−/− mice (4 weeks old) using TRIzol reagent (Invitrogen, Calsbad, CA). To avoid genomic DNA contamination, the extracted RNA was purified using an RNeasy kit (Invitrogen). The quantity and quality of the RNA were determined by measuring the optical density (OD) at 260 and 280 nm. A 2 µg of RNA were used for cDNA synthesis using an oligo‐(dt)₁₅ primer and M‐MLV reverse transcriptase. The reverse transcription (RT) reaction included an initial 10 min incubation at room temperature, followed by 60 min at 42°C and 10 min at 70°C to terminate the reaction. Subsequently, a 2 µl aliquot of cDNA was PCR amplified in a total volume of 25 µl containing 2.5 µl of 10 × PCR buffer (0.2 M Tris‐HCl (pH 8.4), and 0.5 M KCl), 0.2 mM dNTP mix, 1.5 mM MgCl₂, 0.2 µM each primer, and 1.25 units of Platinum Taq DNA polymerase (Invitrogen). The thermal cycler profile was 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 55–60°C for 30 s, and 72°C for 30 s, with a final extension step at 72°C for 10 min. The specific primers for RT‐PCR are described in Table 1. The PCR products were then electrophoresed on a 2% acrylamide gel and visualized using a gel documentation system (Bio‐Rad, Hercules, CA).

Total RNA was isolated from the liver biopsy samples, using the RNeasy kit (Invitrogen life technologies, Carlsbad, CA), according to the manufacturer’s protocol, and a new high-resolution array from Affymetrix, GeneChip Human Transcriptome Array 2.0 (HTA2.0), was undertaken at the UTSWMC core facility to interrogate all transcript isoforms in the human transcriptome with 6 million probes targeting coding transcripts, exon-exon splice junctions, and non-coding transcripts to identify molecular signatures in each of the early and advanced stages of liver disease from HCV mono- and HIV-1/HCV-co-infected liver samples. To evaluate the microarray data, we employed one-way between-subject ANOVA (unpaired) and ANOVA p-value (condition pair) analysis wherein a p-value of < 0.05 was considered statistically significant (*). Fold change (linear) <-2 or fold change (linear) >2 was used as default filter criteria.

Total RNA from ABCG2-positive, ABCG2-negative and unsorted keratinocytes was isolated using the RNeasy kit (Gibco, Invitrogen). The RNA was quantified by its absorption at 260 nm using a NanoDrop spectrophotometer (ND-1000; NanoDrop Technologies, Thermo Scientific, Singapore) and stored at −80°C until use. A housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase, was used as an internal control. The mRNA expression level of different molecular markers was analyzed by semiquantitative RT-PCR as described previously [20 (link)]. Briefly, 1 μg total RNA was used to synthesize first-strand cDNAs with Superscript first-strand System (Gibco, Invitrogen). PCR amplification was performed with specific primer pairs designed from published human gene sequences for different markers [20 (link)]. The fidelity of the RT-PCR products was verified by comparing their size with expected cDNA bands and sequencing the PCR products. The PCR products were also visualized on 1.8% agarose gel.

Total RNA was extracted from the fresh-frozen biopsies using the RNeasy Kit (Invitrogen Life Technologies, Grand Island, NY, USA) according to the manufacturer's instructions. Total RNA quantity and quality isolated from each sample were assessed using a NanoVue spectrophotometer (GE Healthcare, Piscataway, NJ, USA), with a 260/280 ratio of >1.8 and 28S/18S ratio of >1.4 for the majority of the samples. The cDNA was synthesized with SYBR PrimeScript RT reagent kit (TaKaRa, Dalian, China) according to the manufacturer's instructions. Quantitative real-time RT-PCR was performed in the ABI prism 7900 HT sequence detector (Applied Biosystems, Foster City, CA, USA) using SYBR green methodology. β-Actin was used as the endogenous reference gene. All primers were synthesized and purchased from Sheng Gong BioTech (Shanghai, China) and used according to standard methodologies. All PCR reactions were run in triplicate and performed with 40 cycles using the following conditions: 95°C for 1 min, followed by 40 cycles at 95°C for 15 sec and 60°C for 30 sec. The relative target gene expression levels were calculated as a ratio relative to the β-actin reference mRNA. Quantitative real-time PCR analysis was carried out using the 2^−ΔΔCt method [21 (link)–23 (link)].