Mirna universal cdna synthesis kit 2

Total RNA including miRNAs was extracted from murine CD4⁺ T cells using miRNAeasy Kit (#217004, Qiagen, Germany). The mRNA (1 μg) and miRNAs (100 ng) were separately reverse transcribed using Superscript III First-Strand synthesis system (#18080-51, Invitrogen, Germany) and miRNA universal cDNA synthesis kit II (#203301, Exiqon) for reverse transcript PCR (RT-PCR) and subsequent real-time quantitative PCR (qRT-PCR). Detection of gene expression was performed with KapaFast-SYBR Green (#KAPBKK4606, Peqlab, Germany) and measurements were performed on a BioRad iCycler iQ^TM Real-Time PCR Detection System (Bio-Rad Laboratories, Germany). The relative expression levels of mRNAs were normalized to that of GAPDH, whereas the relative expression levels of miRNAs were normalized to that of 5S rRNA. The following primers were used to detect STIM2 and Orai1 expression. For amplification of different miRNAs, hsa-miR-15b-5p LNA™ PCR primer set (#204243, Exiqon), and reference 5S rRNA primer set (#203906, Exiqon) were used and the reaction was set up as recommended by Exiqon or described earlier [47 (link), 48 (link)].
STIM2-F 5’-TGTCTGTGTCAAGTTGCCCT-3’
STIM2-R 5’-TGTCTGGCACTTCCCATTGT-3’
Orai1-F 5’- CCTGGCGCAAGCTCTACTTA-3’
Orai1-R 5’- CATCGCTACCATGGCGAAGC-3’
GAPDH-F 5’-CGTCCCGTAGACAAAATGGT -3’
GAPDH-R 5’-TTGATGGCAACAATCTCCAC-3’

Total RNA including miRNAs was extracted from CD4⁺ T cells using miRNAeasy Kit (#217004, Qiagen, Germany). The mRNA (1 μg) and miRNAs (100 ng) were separately reverse transcribed using Superscript III First-Strand synthesis system (#18080-51, Invitrogen, Germany) and miRNA universal cDNA synthesis kit II (#203301, Exiqon, Denmark) for reverse transcript PCR (RT-PCR) and subsequent real-time quantitative PCR (qRT-PCR). Detection of gene expression was performed with KapaFast-SYBR Green (#KAPBKK4606, Peqlab, Germany) and measurements were performed on a BioRad iCycler iQ^TM Real-Time PCR Detection System (Bio-Rad Laboratories). The relative expression levels of mRNAs were normalized to that of GAPDH, whereas the relative expression levels of miRNAs were normalized to that of 5S rRNA. The following murine primers were used to detect Orai1, STIM1, and STIM2 expression (53 (link)).
For amplification of different miRNAs, hsa-miR-10a-5p LNA™ PCR primer set (#204778, Exiqon, Denmark), hsa-miR-15b-5p LNA™ PCR primer set (#204243), hsa-miR-29a-3p LNA™ PCR primer set (#204698), hsa-miR-146a-5p LNA™ PCR primer set (#204688), mmu-miR-155-5p LNA™ PCR primer set (#205930), and reference 5S rRNA primer set (#203906) were used and the reaction was set up as recommended by Exiqon or described earlier (54 (link)–56 (link)).

A standard curve using defined copy numbers of mimics of miR-451a (Ambion mirVana miR-451a mimic, AAACCGUUACCAUUACUGAUU) was created using qRT-PCR. The molecular weight and starting copy number/μl were calculated. Serial dilutions were prepared, starting with undiluted mimics (10¹³ molecules/μl) including 7 dilutions and converted into cDNA using miRNA Universal cDNA Synthesis Kit II from Exiqon. qPCR was done as described above. Standard curves were designed by plotting the measured Ct-values on the y-axis against natural logarithmic (ln) values of the specific copy number of mimic used as described earlier [17 (link)]. A trend line was plotted through the data points and the resulting formula was used to calculate the copy number per 20 ng used miRNA using Microsoft Excel 2010 (Microsoft Corporation).
The copy number/20 ng miRNA was normalized by multiplication with a normalisation factor [17 (link)] generated using spike-in before cDNA synthesis (Exiqon).