Total RNA extraction from cells and DNase treatment were performed with a Maxwell LEV simplyRNA purification kit (Promega), followed by cDNA synthesis (NEB, Invitrogen). Quantification of relative SERINC5 and IFIT1 mRNA levels was performed with the 7500 Fast real-time PCR system (Applied Biosystems) using TaqMan PCR technology with premade primer-probe kits (Applied Biosystems). Relative mRNA levels were determined using the ΔΔCT method, with human RNASEP mRNA (Applied Biosystems) as an internal reference. Each sample was analyzed in triplicates. Data analysis was performed using Applied Biosystems 7500 Fast system software.
7500 fast system software
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7500 Fast System Software is a software application designed to operate the 7500 Fast Real-Time PCR System, a thermal cycler used for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. The software provides the necessary functionality to control the instrument, design experiments, and analyze the generated data.
Automatically generated - may contain errors
Lab products found in correlation
7500 fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Maxwell lev simplyrna purification kit, by Promega (1 mentions)
Taqman pcr technology, by Thermo Fisher Scientific (1 mentions)
Primer express 3, by Thermo Fisher Scientific (1 mentions)
Abi 7500 fast sequence detection system, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
On column deoxyribonuclease 1 step, by Qiagen (1 mentions)
Quantstudio real time pcr software, by Thermo Fisher Scientific (1 mentions)
Taqman universal master mix, by Thermo Fisher Scientific (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
6 protocols using 7500 fast system software
1
Quantification of SERINC5 and IFIT1 mRNA
2
Cardiac mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated from the left ventricle of the heart (n = 5 per group) using QIAzol lysis reagent and Qiagen RNeasy mini kit (Qiagen) with on-column deoxyribonuclease I step (Qiagen) according to manufacturer’s protocol as previously described16 (link). 2 μg of mRNA was reverse transcribed into cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time polymerase chain reaction (RT-PCR) was detected on ABI 7500 Fast Sequence Detection System (Applied Biosystems) and analyzed by 7500 Fast System Software (Applied Biosystems). Primers and probes (Supplementary table 1 ) were designed with PrimerExpress 3.0 (Applied Biosystems) and synthesized by Biotez (Germany). Analysis of target mRNA expression was performed with RT-PCR using the relative standard curve method. The expression level of the target genes was normalized by the expression of the 18S housekeeping gene. Samples were run in triplicates and mean was used for further calculations. The arbitrary units reflect the ratio of the target mRNA concentration divided by the concentration of 18S of the same sample.
3
Quantitative Comparison of LPA Receptor Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative comparison of the LPA receptor gene expression, data extracted from each qRT‐PCR run was analyzed using the 7500 Fast system software and the QuantStudio Real‐Time PCR software (both from Applied Biosystems, Foster City, CA, USA). The value of the noise fluorescence, usually indicated as the baseline of the run, was automatically determined. The Ct was automatically calculated and used to quantify the starting copy number of the target mRNA. Normalization of LPA receptor genes in brain tissue, astrocytes, microglia cells, and oligodendrocytes was evaluated to internal control of GAPDH and HPRT expression by means of the 2‐dCt method.100 Normalization of LPA gene expression in primary neurons was carried out in addition to internal control of Pgk‐1 using the same method.
4
Quantifying siRNA Knockdown via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated from siRNA-transfected cells and MØ using RNeasy Mini Kits (Qiagen). CD63 specific primers and probe were purchased from Applied Biosytems (Carlsbad, CA). All reactions were performed using Applied Biosystems TaqMan Universal Master Mix and run using an Applied Biosystems 7500 Fast Real Time PCR system and 7500 Fast System Software. Silencing of target genes was determined by normalizing target gene expression to GAPDH expression (n = 3).
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from root and shoot of 5-day-old seedlings in T3 generation using Trizol® reagent (Invitrogen, USA) and the RNA was treated with DNase I (Thermo Fisher Scientific Inc., USA) to remove genomic DNA contamination. First-strand cDNA was synthesized by RevertAid™ first strand cDNA synthesis kit (Thermo Fisher Scientific Inc., USA). Quantitative real-time PCR (qRT-PCR) was performed using Taqman hydrolysis probes (Roche, Switzerland) on 7500 FAST Real Time PCR system (Applied Biosystem, Inc., USA). Total reaction volume of 25 µl included 0.5 µl cDNA, 2.25 µl forward primer, 2.25 µl reverse primer, 0.25 µl probe (Roche Ltd., Switzerland), 12.5 µl Taqman® Gene Expression Mastermix (Applied Biosystems Ltd., USA) and 7.25 µl H2O. Primers were designed using Roche primer design website (https://lifescience.roche.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1&storeId=15006 ). Probe number and primer sequences are provided in Supplementary Table 2. The Ct value was obtained from 7500 Fast System Software (Applied Biosystems, Inc., USA). Primer efficiency was calculated by LinReg PCR (Tuomi et al. 2010 (link)). The data of qRT-PCR was normalized as described by Schefe et al. (2006 (link)).
6
Quantifying Lung Metastases via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lung metastases were detected by the quantitative-PCR (qPCR) method using a set of primers specific for the RCAS provirus (CTTCCCTGCCGCTTCC; FWD: AGCCGCCTCAAGTCATGATG; GCTCTTTCCAATGTACCGATAACCT). DNA was extracted from the largest, left-most lobe of the lung. A mammary tumor induced by RCAS-caErbB2 was used as positive control, and a lung from a FVB mouse without virus injection was used as negative control. The relative amounts of the RCAS provirus with respect to the endogenous gene β-actin were determined using the 7500 Fast System software provided by Applied Biosystems.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!