To show that pomalidomide-dependent protein degradation of ZMYM2 is downregulated at the post-translational level, ZMYM2 mRNA expression in HEK293T or IMR32 cells treated with pomalidomide or DMSO (0.1%) for 24 h was examined by qRT-PCR. Total RNA was isolated from the cells using the SuperPrep Cell Lysis Kit (Toyobo) and cDNA was synthesised using the SuperPrep RT kit (Toyobo), according to the manufacturer’s protocol. RT-PCR was performed using KOD SYBR qPCR Mix (Toyobo) and the data were normalised against GAPDH mRNA levels. PCR primers were as follows: ZMYM2 sense 5′-CTAACTGAGATTCGCCATGAAGTC-3′, ZMYM2 antisense 5′-CTCTCCACACTGTTCACAGCAATTC-3′, GAPDH sense 5′-AGCAACAGGGTGGTGGAC-3′, and GAPDH antisense 5′-GTGTGGTGGGGGACTGAG-3′.
Superprep rt kit
Manufactured by Toyobo
The SuperPrep RT kit is a laboratory equipment product that enables the preparation of complementary DNA (cDNA) from RNA samples. It provides the necessary reagents and protocols for the reverse transcription process, which is a crucial step in gene expression analysis and other molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using superprep rt kit
1
Pomalidomide Regulation of ZMYM2 Expression
2
Evaluating PLZF and SALL4 mRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To demonstrate decreased post‐translational level of PLZF protein, PLZF mRNA expression in HEK293T, HuH7 or THP‐1 cells treated with DMSO or lenalidomide for 24 h was assessed by qRT–PCR. To analyse SALL4 or PLZF mRNA expression, HuH7 cells treated with DMSO, thalidomide or 5‐hydroxythalidomide for 24 h were assessed by qRT–PCR. Total RNA was isolated from HEK293T, HuH7 or THP‐1 cells treated with DMSO or lenalidomide for 24 h using a SuperPrep cell lysis kit (Toyobo). cDNA was synthesised using a SuperPrep RT kit (Toyobo) according to the manufacturer's protocol. RT–PCR was performed using a KOD SYBR qPCR Mix (Toyobo), and data were normalised against glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) mRNA levels. PCR primers were as follows: PLZF FW 5′‐GCACAGTTTTCGAAGGAGGA‐3′, PLZF RV 5′‐GGCCATGTCAGTGCCAGT‐3′, SALL4 FW 5′‐GGTCCTCGAGCAGATCTTGT‐3′, SALL4 RV 5′‐GGCATCCAGAGACAGACCTT‐3′, GAPDH FW 5′‐AGCAACAGGGTGGTGGAC‐3′, GAPDH RV 5′‐GTGTGGTGGGGGACTGAG‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!