The largest database of trusted experimental protocols

8 protocols using plko 3g

1

Lentiviral Knockdown of NgR1 and NgR2 in MN1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
shRNA sequences for NgR1 and NgR2 were obtained of Sigma-Aldrich (St. Louis, MO, USA, Mission shRNA). These sequences were ligated to the eGFP-expressing lentiviral vector pLKO.3G (Addgene, Cambridge, MA, USA) via sites EcoRI and PacI. We used as control shRNA ‘scrambled' sequences designed using the siRNA Wizard Program (InvivoGen, San Diego, CA, USA). Oligonucleotide shRNA sequences were as follows: NgR1: 5′-AATTCTCTACCTACAAGACAACAAT-3′, NgR2:5′-AATTGGTCAGCCTACAGTACCTCTA-3′ and scrambled: 5′-CCTAAGGTTAAGTCGCCCTCGCTCG-3′. Lentiviral vectors were produced by transient cotransfection of human embryonic kidney 293T cells in DMEM containing 10% FBS, using the recombinant plasmid-pLKO.3G carrying transgene sequences, sequences encoding helper (packaging) PsPax2 (Addgene) functions and sequences encoding Env glycoproteins PMD2.G (Addgene). At 48–60 h postransfection, lentiviral vector stocks were concentrated by ultracentrifugation and titrated by flow cytometric (FACS) methods via infection of HEK 293 T cells.
Differentiated MN1 cells were infected by addition of lentiviral particles carrying shRNA sequences for NgR1 and NgR2 at 1 × 104 pfu for 4 days. MN1 cells infected with the virus were identified by eGFP expression. Expression levels of the receptors were monitored by western blotting with receptor-specific antibodies.
+ Open protocol
+ Expand
2

Generating Genetically Mosaic Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
Gata-DKO and control TSCs were transfected with pLKO.3G (Addgene plasmid 14748) and cell sorted (flow cytometry is described in the supplementary Materials and Methods) for strong GFP expression. Sorted cells were cultured in the presence or absence of tamoxifen. Gene deletions were confirmed by PCR. Eight to ten TSCs were microinjected into morulae or very early stage blastocysts using standard techniques. Embryos were allowed to grow to expanded blastocyst stage and micrographed for GFP fluorescence.
+ Open protocol
+ Expand
3

Lentiviral Transduction of Splenocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
A total of 1 × 106 splenocytes were stimulated with 5 µg/mL of LPS (InvivoGen) for 2 or 4 d in complete culture medium composed of Roswell Park Memory Institute medium (RPMI) supplemented with 10% fetal calf serum (Sigma), 0.05 mM 2-mercaptoethanol, 100 U/mL penicillin–streptomycin, 1 mM sodium pyruvate, and 0.1 mM nonessential amino acids (Gibco). Where indicated, cells were treated with 20 μM M1 and 10 μM Mdivi (Sigma) for 2 d from day 2 to day 4.
Stx5a-specific shRNAs were designed thanks to the RNAi consortium (https://portals.broadinstitute.org/gpp/public) and cloned in the pLKO.3G (Addgene #14748) vectors. Lentiviral particles were produced in the Human Embryonic Kidney 293T (HEK293T) cell line with the psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) vectors. For primary cell transduction, splenocytes were put in culture in complete culture medium in the presence of 80 ng/mL CD40L (Thermo Scientific) and 1 U/mL interleukin-4 (Miltenyi) for 24 h to promote B cell entry into cycle. The cells were then washed and transduced with lentiviral particles together with polybrene. After 24 h, cells were washed and differentiated into PCs by addition of LPS as indicated above.
+ Open protocol
+ Expand
4

Lentiviral Knockdown of Zinc Transporter Zip8

Check if the same lab product or an alternative is used in the 5 most similar protocols
A lentiviral system was used to deliver a short-hairpin RNA (shRNA) into primary hippocampal neurons. The Zip8 targeting siRNA sequence was 5′-GTCAAGTTCATGCACCTGTTT-3′ (Sigma MISSION). A scrambled sequence (5′-CCTAAGGTTAAGTCGCCCTCG-3′) was used as non-target control. The shRNA oligonucleotides were ligated into lentiviral vector pLKO.3G (Addgene). The resulting vector (10 μg) was co-transfected with packaging plasmids pMD2.G (3 μg) and psPAX2 (7 μg) (Addgene) into HEK293T/17 cells to produce the lentivirus. Media containing lentiviral particles was collected at 36, 48 and 60 hours post transfection, filtered through 0.45 μm filters, and concentrated by ultracentrifugation. The titers were estimated in HEK293T cells. Primary cultured hippocampal neurons at day 6 post plating were infected with shRNA lentivirus at MOI of 20 to achieve >90% infection. At 8–10 days post infection, the efficiency of Zip8 knockdown was tested by real-time PCR and immunoblot analysis.
+ Open protocol
+ Expand
5

Generation of Engineered Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
B16F10, Py8119, MC38, and A375 parental cell lines were purchased from ATCC. B16-Ova-ZsGreen cells were described previously, and Py8119-Ova-ZsGreen and MC38-Ova-ZsGreen were generated by the same method (43 (link)). A mCherry expression vector was generated by replacing the corresponding eGFP sequence in pLKO.3G (Addgene plasmid #14748). mCherry+ cells were generated by lentiviral transduction of the parental line and sorted using an Aria III flow cytometer (BD Biosciences) to purity to establish the cell line. All cell lines except for B16F10-Cas9 were grown in complete DMEM media (10% FBS and 50U/ml of penicillin/streptomycin). B16F10-Cas9 cells were maintained in complete DMEM media plus blastcidin (2.5–5μg/ml) to maintain Cas9 expression. Cell lines were confirmed to be negative for Mycoplasma contamination using the ATCC Universal Mycoplasma Detection Kit.
+ Open protocol
+ Expand
6

Lentiviral Knockdown and Overexpression of Epigenetic Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
The shRNA oligonucleotide targeting mouse Ehmt1 (CGCTATGATGATGATGAATAA), Ehmt2 (CCGAGAGAGTTCATAGCTCTT), or Arc (GAGGAGGAGATCATTCAGTAT) sequence was inserted to the lentiviral vector pLKO.3G (Addgene), which contains an eGFP reporter. The virus production was performed as previously described18 (link), 26 (link). Arc CRISPR activation lentiviral particle (Santa Cruz Biotech., sc-419184-LAC) was delivered to PFC for Arc overexpression. See Supplementary Materials and Methods for details.
+ Open protocol
+ Expand
7

Cloning and Mutagenesis of USP49 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
HIS-FLAG-USP49 was purchased from Vigene bioscience (cat# CH806995). USP49C262A mutant was generated by PCR-based site-directed mutagenesis. Other USP49 deletion mutants were sub-cloned into pcDNA3.1 vector with HA or FLAG tag. The vector pLKO.3G, which contains a U6 promoter and gfp selection gene was purchase from Addgene, was used for expression of USP49 shRNA or scrambled control. The pGFP-USP49 was generated by sub-cloning usp49 gene into pEGFP-C1 vector. The pcDNA3.1-A3G-HA/FLAG, pcDNA3.1-GFP-HA/FLAG, and pcDNA3.1-ub-HA/FLAG, pet28a-Vif and pet32a-A3G were constructed as described previously (Chen et al., 2017 (link)). The pNL4-3-Vif-Y40H mutant was generated by digestion of pNL4-3 with Apa I and EcoR I, and followed by PCR-based site-directed mutagenesis. All the constructs were confirmed by sequencing.
+ Open protocol
+ Expand
8

GBM Cell Line Transduction and TNFRSF12A Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two GBM cell lines (U118 and U87) were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China), while GBM cell lines T98 and U251 from Procell Life Science &Technology (Wuhan, China). Above four GBM cell lines were cultured in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin/streptomycin (Beyotime, China) at 37°C with 5% CO2. For transduction, U118 cell lines were maintained at 60% confluence in six-well plates, and viral solutions were added into a cell culture medium that contains 8 μg/mL polybrene (Solarbio, China), then selected using neomycin (Beyotime, China). Endogenous TNFRSF12A was knocked down using an shRNA system (pLKO.3G from Addgene). The target sequence is GAAGTTCACCACCCCCATAGA.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!