Amicon ultra centrifugal filtration unit

Full-length esxN was amplified from M. tuberculosis Erdman genomic DNA by PCR with primers esxNHisF2 (5’gcattcatgacgattaattaccagttcgggga3’) and esxNHisR2 (5’ gcatctcgagggcccagctggagccga3’), digested with BspHI and XhoI and cloned in pET28b+ (Novagen) between the NcoI and XhoI restriction enzyme sites to generate pET28-EsxNHis₆ encoding EsxN with a C-terminal His₆ tag. A plasmid for co-expression of PPE41-His₆ and PE25 was described previously [62 (link)]. Recombinant proteins were produced in E. coli BL21(DE3) and purified by Ni²⁺-NTA affinity chromatography (Qiagen). PPE41-His₆ was bound to the column under native conditions in 20 mM HEPES buffer, 300 mM NaCl, pH 7.8 and eluted in 20 mM HEPES buffer, 500 mM NaCl, pH 7.8 containing 50–150 mM imidazole. EsxN-His₆ was purified under denaturing conditions; protein was bound to the column in 20 mM sodium phosphate buffer, 500 mM NaCl, 6 M guanidine hydrochloride, pH 7.8 and eluted in 20 mM sodium phosphate buffer, 500 mM NaCl, 8 M urea, pH 4. Contaminant proteins that co-purified with EsxN-His₆ were removed by passing eluted fractions through a 50 kDa cut-off Amicon Ultra centrifugal filtration unit (Millipore). Polyclonal antisera against purified EsxN-His₆ and PPE41-His₆ proteins were generated in rabbits by Pierce Custom Antibodies (Thermo Scientific) using TiterMax Gold adjuvant (Sigma).

E2core+stem (residues 456–713) was reconstituted with 2A12 Fab in a 1:1.2 (w/w) and hCD81-LEL was added to it in 1:1.3 molar ratio. The complex was incubated overnight at 4 °C. The complex was purified in 20 mM sodium citrate pH 4.5, 100 mM NaCl buffer by Superdex200 column (Cytiva Life Sciences) size exclusion chromatography. The major peak (Supplementary Fig. 1) was collected and concentrated through a 3 kDa MW cut-off Amicon Ultra Centrifugal Filtration Unit (Millipore) to a final concentration of 5 mg/mL. The analysis of size exclusion chromatography peaks shows that hCD81-LEL does not bind to the complex (Supplementary Fig. 1B). The E2core+stem/2A12 Fab complex was set up on small scale, 400nL, drop size using a mosquito liquid handling system (SPT Labtech) with various crystallization screens (Hampton Research). Diffraction quality crystals were grown in Hampton HR2-139 screen, condition D10; 0.2 M sodium citrate tribasic dihydrate, 20% w/v PEG 3350, pH 8.3. Crystals were directly frozen from 96-well plates using 30% ethylene glycol as a cryoprotectant, and flash-cooled in liquid nitrogen. Data were collected at 0.979 Å at the SER-CAT 22-ID beamline at the APS, Argonne National Laboratory.