The largest database of trusted experimental protocols

Prime script rt detection kit

Manufactured by Takara Bio
Sourced in Japan

The Prime-ScriptTM RT detection kit is a tool for reverse transcription and real-time PCR detection. It enables the conversion of RNA into cDNA and the subsequent amplification and detection of the target sequence.

Automatically generated - may contain errors

3 protocols using prime script rt detection kit

1

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells using RNAiso reagent (Takara Biotechnology, Japan) and RT-PCR assays were performed with the Prime-ScriptTM RT detection kit (Takara Biotechnology) as previously described. Amplification and detection of specific products were performed using the ABI Prism 7500 sequence detection system with the cycles indicated by the Prime-ScriptTMRT detection kit. As an internal control, HPRT primers were used for RNA template normalization. qRT-PCR primers were presented in Table 1. Relative levels of the target gene mRNA expression were calculated and expressed as 2−△△Ct.
+ Open protocol
+ Expand
2

Quantification of Cardiac Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA levels were measured by qRT-PCR. Briefly, RNAs of primary cardiomyocytes were extracted using RNAiso reagent (Takara Biotechnology). Subsequently, total RNA was reverse transcribed to complementary DNA (cDNA) according to the protocol of PrimeScriptTM RT detection kit (for mRNA) or PrimeScriptTM miRNA RT detection kit (for miRNA) (Takara Biotechnology). The RT primer of miRNA-143: 5′ GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTGAGCT 3′; RT primer of U6: 5′ CGCTTCACGAATTTGCGTGTCAT 3′. qPCR Primer sets are indicated in Table 1. All primers were synthesized by Sangon Biotech (Shanghai, China). qPCR reactions were performed using the SYBR Premix Ex TaqTM II kit as described by the protocol. The same thermocycling profile was used for all genes: 95 °C for 10 minutes, followed by 40 cycles of 95 °C for 15 seconds, 58 °C for 30 seconds, and 72 °C for 20 seconds.

List of primers.

GeneForward 5′-3′Rerverse 5′-3′
ANPATACAGTGCGGTGTCCAACACGAGAGCACCTCCATCTCTC
BNPGCTTTGGGCAGAAGATAGACAAGTTTGTGCTGGAAGATAA
β-MHCTGCTGGCACCGTGGACTAGCTTGAGGGAGGACTTCTGG
GAPDHGCCAGCCTCGTCTCATAGACAAGAGAAGGCAGCCCTGGTAAC
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
mir143GGGTGAGATGAAGCACTGTCAGTGCGTGTCGTGGAGT
+ Open protocol
+ Expand
3

Quantitative RT-PCR Analysis of Mouse RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from mouse using RNAiso reagent (Takara Biotechnology). Prime-ScriptTM RT detection kit (Takara Biotechnology) were performed for real-time (RT)-PCR assays using ABI Prism 7500 sequence detection system. Relative levels of the sample mRNA expression were calculated and expressed as 2-DDCt. The primers used for qRT-PCR are shown: 5′-CCATGGCAGACGATGATCCC-3′ and 5′-GTATGGAAGTGATTGTCCAT-3′.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!