Log In Sign up
The largest database of trusted experimental protocols

Physcion

Manufactured by Santa Cruz Biotechnology
Visit Supplier

Physcion is a chemical compound used in laboratory applications. It is a yellow crystalline solid that is soluble in organic solvents. Physcion has been utilized in various research and analytical procedures, though its specific core function is not elaborated on further.

Automatically generated - may contain errors

Lab products found in correlation

Antibody against β actin, by Merck Group (2 mentions) Phospho ampk t172, by Cell Signaling Technology (2 mentions) Phospho acc1 s79, by Cell Signaling Technology (2 mentions) Antibody against 6pgd, by Novus Biologicals (2 mentions) Prediluted ki67 antibody, by Thermo Fisher Scientific (2 mentions) 1 hydroxy 8 methoxy anthraquinone s3, by Merck Group (2 mentions) A 769662, by LC Laboratories (2 mentions) Compound c, by Merck Group (2 mentions) Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (2 mentions) Eicosanoids, by Cayman Chemical (1 mentions) 5 oxo ete, by Santa Cruz Biotechnology (1 mentions) Cisplatin, by Merck Group (1 mentions) β actin, by Santa Cruz Biotechnology (1 mentions)

4 protocols using physcion

1

Eicosanoid Modulation of Cellular Function

Check if the same lab product or an alternative is used in the 5 most similar protocols
Eicosanoids and/or inhibitors (from Cayman Chemical) were applied at the following concentrations: 1.0 nM 5-HETE (#34210), 1.0 nM 5-oxo-ETE (#34250), 7.5 nM MK886 (#21753), 25 μM Gue1654 (#29686), 100 nM physcion (Santa Cruz Biotech SC-205805). Cells were allowed to equilibrate with inhibitors for 30 minutes before experimentation.
Maus K.D., Stephenson D.J., Macknight H.P., Vu N.T., Hoeferlin L.A., Kim M., Diegelmann R.F., Xie X, & Chalfant C.E. (2023). Skewing cPLA2 activity toward oxoeicosanoid production promotes neutrophil N2 polarization, wound healing, and the response to sepsis. Science signaling, 16(793), eadd6527.
+ Open protocol
+ Expand
2

Stable Knockdown of 6PGD, G6PD, and AMPK

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stable KD of endogenous h6PGD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTT -3’). The shRNA is designed to target the 3' non-coding region of h6PGD-A mRNA and shows no effect on the plasmid directed expression of 6PGD cDNA in cells. Stable KD of endogenous hG6PD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT-3’). Stable KD of endogenous hAMPK was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGCATAATAAGTCACAGCCAAACTCGAGTTTGGCTGTGACTTATTATGCTTTTT -3’). Antibodies against AMPK (cat# 5831), phospho-AMPK (T172) (cat# 2535), ACC1 (cat# 3662), and phospho-ACC1 (S79) (cat# 11818), G6PD (cat# 12263), and LKB1 (cat# 3050) were from Cell Signaling Technology (CST); antibody against 6PGD was from Novus (cat# NBP1-31589); antibody against β-actin was from Sigma (cat# A1978); prediluted Ki67 antibody was from Invitrogen (cat# 08-0156). Physcion was purchased from Santa Cruz Biotechnology. 1-hydroxy-8-methoxy-anthraquinone (S3) was purchased Sigma. DHEA was purchased from Calbiochem. DHA was purchased from TCI America. A769662 was purchased from LC Laboratories. Compound C was purchased from EMD Millipore.
Elf S., Lin R., Xia S., Pan Y., Shan C., Wu S., Lonial S., Gaddh M., Arellano M.L., Khoury H.J., Khuri F.R., Lee B.H., Boggon T.J., Fan J, & Chen J. (2016). Targeting 6-phosphogluconate dehydrogenase in the oxidative PPP sensitizes leukemia cells to anti-malarial agent dihydroartemisinin. Oncogene, 36(2), 254-262.
+ Open protocol
+ Expand
3

Antibody and miRNA Modulation in Cell Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibody against 6PGD (1:150 times dilution) (catalog number: sc-398977) and β-actin (1:500 times dilution) (catalog number: sc-47778) was from Santa Cruz Biotech; Cisplatin was purchased from Sigma–Aldrich (catalog number: P4394); Physcion was purchased from Santa Cruz Biotech (catalog number: sc-205805). The miR-206, miR-613 and miRNA Mimic Negative Control (Mimic NC, miRNA Mimic Negative Controls show the minimal homology to all known miRNAs of miRBase 18.0, and it is a crucial experimental control for miRNA “gain-of-function” studies)and miR-206 inhibitor, miR-613 inhibitor and miRNA Inhibitor Negative Control (Inhibitor NC, micrOFFTM miRNA Inhibitor Negative Control is designed for minimum homology to the miRNAs being studied, and thus an indispensable control for miRNA functional studies) were purchased from RiboBio Co. Ltd. Lipofectamine RNAiMAX transfection reagent was purchased from Thermo Fisher Scientific (catalog number: 13778-150).
Zheng W., Feng Q., Liu J., Guo Y., Gao L., Li R., Xu M., Yan G., Yin Z., Zhang S., Liu S, & Shan C. (2017). Inhibition of 6-phosphogluconate Dehydrogenase Reverses Cisplatin Resistance in Ovarian and Lung Cancer. Frontiers in Pharmacology, 8, 421.
+ Open protocol
+ Expand
4

Stable Knockdown of 6PGD, G6PD, and AMPK

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stable KD of endogenous h6PGD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTT -3’). The shRNA is designed to target the 3' non-coding region of h6PGD-A mRNA and shows no effect on the plasmid directed expression of 6PGD cDNA in cells. Stable KD of endogenous hG6PD was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGCCCTGAAGTGACTGAGACAATCTCGAGATTGTCTCAGTCACTTCAGGGTTTTT-3’). Stable KD of endogenous hAMPK was achieved using lentiviral vector harboring shRNA construct (Open Biosystems; 5’-CCGGGCATAATAAGTCACAGCCAAACTCGAGTTTGGCTGTGACTTATTATGCTTTTT -3’). Antibodies against AMPK (cat# 5831), phospho-AMPK (T172) (cat# 2535), ACC1 (cat# 3662), and phospho-ACC1 (S79) (cat# 11818), G6PD (cat# 12263), and LKB1 (cat# 3050) were from Cell Signaling Technology (CST); antibody against 6PGD was from Novus (cat# NBP1-31589); antibody against β-actin was from Sigma (cat# A1978); prediluted Ki67 antibody was from Invitrogen (cat# 08-0156). Physcion was purchased from Santa Cruz Biotechnology. 1-hydroxy-8-methoxy-anthraquinone (S3) was purchased Sigma. DHEA was purchased from Calbiochem. DHA was purchased from TCI America. A769662 was purchased from LC Laboratories. Compound C was purchased from EMD Millipore.
Elf S., Lin R., Xia S., Pan Y., Shan C., Wu S., Lonial S., Gaddh M., Arellano M.L., Khoury H.J., Khuri F.R., Lee B.H., Boggon T.J., Fan J, & Chen J. (2016). Targeting 6-phosphogluconate dehydrogenase in the oxidative PPP sensitizes leukemia cells to anti-malarial agent dihydroartemisinin. Oncogene, 36(2), 254-262.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!