Total RNA was isolated with Isogen II (Nippon Gene) and cDNA was synthesized with the ReverTra Ace kit with genomic DNA remover (Toyobo). Real‐time PCR was performed with the Thunderbird SYBR quantitative PCR (qPCR) mix (Toyobo) and the CFX96 Touch real‐time PCR detection system (Bio‐Rad). The expression levels of selected genes were quantified based on the standard curve method, and the values were normalized with the TATA box binding protein (TBP). Primer sequences used are as follows: TBP [forward (F) 5ʹ–CAGATGTGCGTCAGGCGTTC–3ʹ and reverse (R) 5ʹ–TAGTGATGCTGGGCACTGCG–3ʹ]; MuRF‐1 [F 5ʹ–TGATTCTCGATGGAAACGCTATGG–3ʹ and R 5ʹ–ATTCGCAGCCTGGAAGATGTC–3ʹ]; Atrogin‐1 [F 5ʹ–GACAAAGGGCAGCTGGATTGG–3ʹ and R 5ʹ–TCAGTGCCCTTCCAGGAGAGA–3ʹ]; Myostatin [F 5ʹ–ACCAGGAGAAGATGGGCTGAATC–3ʹ and R 5ʹ–GGGATTCCGTGGAGTGCTCA–3ʹ]; Androgen receptor (AR) [F 5ʹ–CAGGAGGAAGGAGAAAACTCCA–3ʹ and R 5ʹ–ATTGACAAGGCAGCAAAGGAATC–3ʹ]; zinc finger MYND domain‐containing protein 17 (Zmynd17) [F 5ʹ–TAGGGCTTAACAGGCACTGGTCCCC–3ʹ and R 5ʹ–TTCTTGTGCTTTCGCCGCCGTG–3ʹ].
Revertra ace kit with genomic dna remover
Manufactured by Toyobo
Sourced in Japan
The ReverTra Ace kit with genomic DNA remover is a laboratory product designed for reverse transcription of RNA. It includes a genomic DNA removal reagent to eliminate genomic DNA contamination prior to reverse transcription.
Automatically generated - may contain errors
Lab products found in correlation
Cfx96 touch real time pcr detection system, by Bio-Rad (3 mentions)
Isogen 2, by Nippon Gene (3 mentions)
Thunderbird sybr quantitative pcr qpcr mix, by Toyobo (1 mentions)
Thunderbird sybr quantitative pcr mix, by Toyobo (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Thunderbird sybr qpcr mix, by Toyobo (1 mentions)
4 protocols using revertra ace kit with genomic dna remover
1
qPCR Analysis of Muscle Atrophy Genes
2
Quantitative Real-Time PCR for mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR was performed to determine mRNA expression levels. Total RNA was extracted from muscle using Isogen II (Nippon Gene, Tokyo, Japan), according to the manufacturer’s instructions. RNA was reverse transcribed into cDNA using a ReverTra Ace kit with genomic DNA remover (Toyobo, Tokyo, Japan). Real-time PCR was performed with Thunderbird SYBR quantitative PCR mix (Toyobo, Tokyo, Japan) and CFX96 Touch real-time PCR detection system (Bio-Rad, Tokyo, Japan). The expression levels of selected genes were analyzed using standard curve method and the values were normalized against TATA box binding protein (TBP). Primer sequences were as follows: TBP [forward(F) 5′-CAGATGTGCGTCAGGCGTTC-3′ and reverse (R) 5′-TAGTGATGCTGGGCACTGCG-3′]; Zmynd17 (F 5′-TAGGGCTTAACAGGCACTGGTCCCC-3′ and R 5′-TTCTTGTGCTTTCGCCGCCGTG-3′).
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using TRIzol reagent (Life Technology) according to the manufacturer’s instructions. cDNA was synthesized using a ReverTra Ace Kit with genomic DNA remover (Toyobo). RT-qPCR was performed using Thunderbird SYBR Green in a 7500 Fast Real-Time PCR System (Applied Biosystems). RT-PCR primer sequences are listed in Table S3 . Quantitative data were obtained in triplicate within a single experiment. All data were normalized to an internal control (TATA-box binding protein, TBP).
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with Isogen II (Nippon Gene), and complementary DNA was synthesized with ReverTra Ace kit with genomic DNA remover (Toyobo). Real-time PCR was performed with the Thunderbird SYBR qPCR mix (Toyobo) and CFX96 Touch real-time PCR detection system (Bio-Rad). The expression levels of selected genes were quantified on the basis of the standard curve method, and the values were normalized with TATA box binding protein (TBP), GAPDH, or 18S ribosomal RNA (18S). Primer sequences are listed in table S1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!