Px459

The University of California Santa Cruz Genome Browser Gateway¹ was used to define the genomic region of mouse exon 3 and exon 10a protein coding regions for guide RNA (gRNA) design. The genomic region for mouse exon 3 and exon 10a was chr18:69,347,299–69,347,369 and chr18:69,593,516–69,593,584, respectively, according to mouse GRCm38/mm10 (Dec. 2011) assembly. In total, three gRNAs were designed for exon 3 and two for exon 10a using Benchling Inc.² CRISPR guide design software.
To insert the gRNA targeting region-containing oligonucleotides effectively into the PX459 (Addgene #62988) expression vector, nucleotides were added to the 5` ends of gRNAs that were complementary to the sticky ends produced after restriction of the PX459 plasmid with the BbsI restriction enzyme (Thermo Scientific). In addition, a guanine nucleotide was added to the 5′ end of each forward oligonucleotide sequence of gRNA as it has been found to increase targeting efficiency.³ The designed sequences are included in Supplementary Table S2. The oligonucleotides were ordered from Microsynth AG.

Guide RNA sequences were cloned into the plasmid px459 (Addgene, 62988). px459 plasmids containing Dnmt3a guide RNAs were co-transfected into digested ASCs using Lipofectamine 2000 (Thermo Fisher). Further information is provided in Supplemental experimental procedures.

The 20 nucleotide guide sequences targeting human Girdin were designed using the CRISPR design tool at http://www.genome-engineering.org/crispr/ and cloned into a bicistronic expression vector pX459 (Addgene #48139). The guide sequence targeting exon 9 of human Girdin was 5′-GGAAGTGACTGATATGTCGC-3′. The single guide RNAs (sgRNAs) in the pX459 vector (1 μg) were transfected into targeting cells in a 3.5-cm dish using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Twenty-four hours post-transfection, the cells were trypsinized and seeded in a 10-cm dish; puromycin (2 μg/mL) was added 24 h later for selection. Forty-eight hours after selection, the cells were trypsinized and seeded into a 96-well plate (4 cells per well). Single clones were expanded and screened for Girdin expression by protein immunoblotting.

px459 (Addgene) was used to express Cas9 and guide RNA sequence along with a Puromycin resistance cassette according to published procedures (Ran et al., 2013 (link)). Two guide RNA sequences were cloned separately to obtain two independent knock-out colonies. Sequences were ACGCTTCAATGCTCTCTCGC and AGAGAGCATTGAAGCGTAAC, both located in the beginning of the second exon of the mouse Piezo1 gene. hB9-GFP mES cells were then transfected with the px459 vector using Lipofectamine 2000 (Invitrogen) and selected with 1 µg/ml Puromycin for 2 day. After 1 day of recovery in Puromycin-free medium, transfected cells were dissociated and sparsely re-plated into 10 cm dishes. Single colonies were isolated after 7 days, expanded, and DNA was extracted using QuickExtract DNA Extraction solution (Epicentre). A 500 bp region containing the Cas9 target was amplified by PCR using the following primers: CGTGTGCATCCACGTATGA and AGGTGTGCACTGAAGGAACC. Obtained fragment was then sequenced. Sequencing results showed that some colonies contained a mix of 2 sequences, indicating differential mutations in both alleles of the Piezo1 gene. However, four colonies showed a clear single sequence, indicating a homozygous mutation near the PAM sequence. Two of those colonies were selected for electrophysiological studies. A third colony was added to the studies for figure 7.