A1517001

Manufactured by Thermo Fisher Scientific

Sourced in United States

The A1517001 is a laboratory centrifuge designed for a variety of applications. It has a maximum speed of 14,000 RPM and can achieve a maximum relative centrifugal force of 20,000 x g. The centrifuge is capable of accommodating a range of sample tube sizes and volumes. Detailed specifications and intended use cases are not available.

Automatically generated - may contain errors

Lab products found in correlation

6 protocols using a1517001

Maintaining Human iPSCs in E8 Medium

Check if the same lab product or an alternative is used in the 5 most similar protocols

Essential 8 (E8) medium: The Essential 8 (E8) complete medium was prepared by adding 1 mL of E8 supplement (Fisher #A1517001) to 50 mL of base E8 media (Fisher #A1517001).
Human induced Pluripotent Stem Cells (iPSCs) were maintained in E8 medium in presence of 10 µM Y27632 (Rock inhibitor; R&D Systems #1254) on Matrigel (Corning #354277) coated culture plates. Cells were grown at 37°C, 5% CO₂ atmosphere and cells were passaged when 70% confluent with Versene (Gibco #15040066).

Majumder J., Torr E.E., Aisenbrey E.A., Lebakken C.S., Favreau P.F., Richards W.D., Yin Y., Chang Q, & Murphy W.L. (2024). Human induced pluripotent stem cell-derived planar neural organoids assembled on synthetic hydrogels. Journal of Tissue Engineering, 15, 20417314241230633.

+ Open protocol

+ Expand

Generation of iPSC Lines from Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

CS iPSC and control iPSC lines were generated using a non-integrating induction method with episomal vectors from human skin fibroblasts obtained via skin biopsy, as described previously [13 (link)]. Briefly, on day 7 after electroporation, cells were reseeded onto a feeder layer of mouse embryonic fibroblasts (MEFs). iPSC lines were maintained using an embryonic stem cell (ESC) medium containing 20% knockout serum (10828-028, Gibco, Carlsbad, CA, USA), beta-mercaptoethanol (21985-023, Gibco, Carlsbad, CA, USA), 1× GlutaMAX (3500-061, Gibco, Carlsbad, CA, USA), 1× MEM-NEAA (1140-050, Gibco, USA), penicillin/streptomycin (15140-122, Gibco, Carlsbad, CA, USA), and DMEM-F12 (11320-033, Gibco, Carlsbad, CA, USA). After 1 month, iPSC-like colonies were picked and reseeded on new feeder cells. We changed the iPSC culture system from MEF feeder-dependent to the feeder-free culture system using the essential 8 medium (A1517001, Gibco, Carlsbad, CA, USA) at passage 5–7. To confirm the mutation in the VPS13B gene in the iPSCs, we performed a genomic PCR using specific primers (VPS13B sense (1)-5′-CCGGACTGCAAGACCAAAGA, antisense (1)-5′-TGGCTGGATCACCAGTTTCC; sense (2)-5′-CAACTGAGTGGAGTGATGCCA, antisense (2)-5′- GCTGGATCACCAGTTTCCGTA).

Lee Y.K., Hwang S.K., Lee S.K., Yang J.E., Kwak J.H., Seo H., Ahn H., Lee Y.S., Kim J., Lim C.S., Kaang B.K., Lee J.H., Lee J.A, & Lee K. (2020). Cohen Syndrome Patient iPSC-Derived Neurospheres and Forebrain-Like Glutamatergic Neurons Reveal Reduced Proliferation of Neural Progenitor Cells and Altered Expression of Synapse Genes. Journal of Clinical Medicine, 9(6), 1886.

+ Open protocol

+ Expand

Differentiation of iPSC-Derived Endothelial Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

E7VI medium: DF3S base media (Gibco #ME110262L1), SB341542 (5 µM), VEGFA165 (50 ng/mL), FGF2 (100 ng/mL), Transferrin (10.7 µg/mL), Insulin (20 µg/mL).
E8BAC medium: E8 base media (Gibco #A1517001), BMP4 (5 ng/mL), Activin A (25 ng/mL), CHIR 99021 (1 µM).
Differentiation of endothelial cells (ECs) was carried out following our previously published protocol.^{73 (link)} Human induced pluripotent stem cells (iPSCs) were grown in E8 media on Matrigel coated plate. Next, cells were dissociated using Versene (Gibco #15040066) and incubate for 3–5 min at 37°C until colonies detach. Cells were cultured in Matrigel coated wells of 6 well plates in E8BAC media for 2 days (to 100% confluence) with the addition of 10 µM Y27632 (R&D Systems #1254/10). Cells were then grown in E7VI medium for an additional 3 days. Cells were then harvested with Accutase (Gibco #A1110501) to produce a single cell suspension and centrifuged at 300×g for 5 min and resuspend 1 × 10⁸ cells in 300 µL of cold MACS buffer consisting of 1× PBS, 0.5% BSA (Fisher #BP1600), and 2 mM EDTA (Invitrogen #15575020). A 100 µL of FcR blocking reagent and 100 µL of CD34 microbeads (Miltenyi Biotec #130-046-702) were added and the mixture was incubated at 4°C for 30 min. Endothelial cells (ECs) were then isolated with CD34 microbeads by auto MACS (Miltenyi) to yield purified populations of CD34⁺CD31⁺ cells, which were cryopreserved.

+ Open protocol

+ Expand

Directed Differentiation of iPSCs into Cardiomyocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human induced pluripotent stem cells (iPSCs) were derived from peripheral blood cells and were maintained in feeder-free culture conditions with E8 medium (A1517001, Gibco) on Geltrex-coated plates (A1413302, Gibco) as previously described (Streckfuss-Bömeke et al., 2013 (link)). Standard directed cardiomyocyte differentiation of iPSCs was initiated at a confluence of 90–100% via Wnt signaling modulation using cardiac differentiation medium (RPMI1640 HEPES Glutamax, 500 mg/L human recombinant albumin, 200 mg/L L-ascorbic acid 2-phosphate). Progressive treatment was applied with 4 μmol/L CHIR99021 (361559, Millipore) for 48 hr and 5 μmol/L IWP2 (681671, Millipore) for further 48 hr. Medium was changed to cardiac culture medium (RPMI1640 HEPES Glutamax, B27 with insulin) at day 10. Cardiomyocytes were enriched using cardiac selection medium (RPMI 1640 minus Glucose, 4 mmol/L Lactate, 500 mg/L human recombinant albumin, 200 mg/L L-ascorbic acid 2-phosphate) for 5 days. iPSC-CMs were then cultured in cardiac culture medium up to 120 days for maturation before any further treatment.

Ruiz-Velasco A., Zi M., Hille S.S., Azam T., Kaur N., Jiang J., Nguyen B., Sekeres K., Binder P., Collins L., Pu F., Xiao H., Guan K., Frey N., Cartwright E.J., Müller O.J., Wang X, & Liu W. (2020). Targeting mir128-3p alleviates myocardial insulin resistance and prevents ischemia-induced heart failure. eLife, 9, e54298.

+ Open protocol

+ Expand

Culturing Conventional Human Pluripotent Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Conventional SHEF6⁶⁵ were cultured on vitronectin-coated dishes (10 μg/mL; A14700, Thermo Fisher Scientific) in E8 medium (A1517001, Thermo Fisher Scientific) under hypoxic conditions (37°C, 5% CO2, 5% O2). Cells were routinely passaged in clumps using 0.5 mM EDTA. hPSC experiments were approved by the UK Stem Cell Bank Steering Committee and comply with the regulations of the UK Code of Practice for the Use of Human Stem Cell Lines.

Bergmann S., Penfold C.A., Slatery E., Siriwardena D., Drummer C., Clark S., Strawbridge S.E., Kishimoto K., Vickers A., Tewary M., Kohler T.N., Hollfelder F., Reik W., Sasaki E., Behr R, & Boroviak T.E. (2022). Spatial profiling of early primate gastrulation in utero. Nature, 609(7925), 136-143.

+ Open protocol

+ Expand

Culturing and Maintaining Human Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cells were cultured and maintained in incubators at 37℃ and 5% CO₂. Human iPSCs were cultured on vitronectin (A31804, Thermo Fisher Scientific, USA)-coated dishes and maintained in E8^TM-based hPSC medium (A1517001, Thermo Fisher Scientific, USA) supplemented with 1X penicillin/streptomycin. Culture medium was changed every day. Human iPSCs were detached from the dish by treatment with ReLeSR^TM passaging reagent (Stemcell^TM) and were dissociated into smaller pieces by tapping. The iPSCs used throughout the study, CMC-hiPSC-003 and CMC-hiPSC-011, were provided by the National Stem Cell Bank of Korea (Korea National Institute of Health), which were originally provided by Catholic University. Human dermal fibroblasts (HDFs) were maintained in FGM2 (CC-3132, Lonza, Switzerland) medium supplemented with 10% fetal bovine serum (FBS) and 1X penicillin/streptomycin. Culture medium was changed every other day. Human umbilical cord blood-derived mesenchymal stem cells (hUCB-MSCs) were obtained and approved for use by the Boramae Hospital Institutional Review Board (IRB) as previously described. hUCB-MSCs were maintained in EGM-2 endothelial growth medium supplemented with 10% FBS and 1X penicillin/streptomycin. HUVECs (ATCC, USA) were cultured in EGM-2 medium (CC-3162, Lonza, Switzerland) supplemented with 10% FBS and 1X penicillin/streptomycin.

Kook M.G., Lee S.E., Shin N., Kong D., Kim D.H., Kim M.S., Kang H.K., Choi S.W, & Kang K.S. (2022). Generation of Cortical Brain Organoid with Vascularization by Assembling with Vascular Spheroid. International Journal of Stem Cells, 15(1), 85-94.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!