Total genomic DNA was extracted using a Quick-DNATM Fecal/Soil Microbe Miniprep Kit (Zymo Research, United States [US]) based on the manufacturer’s protocol with minor modifications. Faecal samples in the Bashing BeadsTM lysis tube (0.1 mm and 0.5 mm) were processed on a Vortex Genie at maximum speed for 25 min, instead of 20 min as recommended by the manufacturer’s protocol. DNA quality and concentration were checked on an agarose gel (1.5%) and NanodropTM 1000 spectrophotometer (Thermo Scientific, US) at 260 nm absorbance.
Quick dnatm fecal soil microbe miniprep kit
Manufactured by Zymo Research
Sourced in United States, Germany
The Quick-DNATM Fecal/Soil Microbe Miniprep Kit is a laboratory equipment product designed for the rapid and efficient extraction of DNA from fecal and soil samples. It provides a simple, streamlined process for obtaining high-quality DNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Miseq reagent kit v3, by Illumina (2 mentions)
Nextera xt, by Illumina (2 mentions)
Miseq platform, by Illumina (2 mentions)
Gridion x5, by Oxford Nanopore (2 mentions)
Nextseq 500, by Illumina (2 mentions)
Nanodroptm 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Gel electrophoresis, by Thermo Fisher Scientific (1 mentions)
Mutanolysine, by Merck Group (1 mentions)
Lysozyme, by Merck Group (1 mentions)
10 protocols using quick dnatm fecal soil microbe miniprep kit
1
Efficient DNA Extraction from Fecal Samples
2
Fecal DNA Isolation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fecal DNA was isolated from the pellets obtained by centrifuging 500 µL of fecal slurry using the Zymo Research kit (Quick-DNATM Fecal/Soil Microbe MiniPrep Kit) following the manufacturer’s protocol (Zymo Research, Irvine, CA). Enzymatic lysis of DNA was performed using lysozyme (20 mg) and mutanolysine (10 KU) (Sigma-Aldrich, Oakville, Canada). The resulting DNA extracts were eluted in 1X TE buffer (Tris and EDTA) and stored at −20 °C until sequencing. DNA quality was assessed by gel electrophoresis (1.2% w/v agarose) (Life Technologies, Madrid, Spain). DNA concentrations were determined using a Qubit (Thermo Fisher Scientific, Waltham, US). DNA samples were stored at −20 °C until preparation of the 16 S rRNA library.
3
Quantitative Detection of C. parvum in Feces
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction was performed using a Zymo Research Quick-DNATM Fecal/Soil Microbe Miniprep Kit, Irvine, CA, USA as per kit instructions using 0.2 g of feces per sample. DNA extracts were analyzed for C. parvum using quantitative polymerase chain reaction (qPCR) within 30 h of extraction. The direct and reverse primer sequences were CATGGATAACCGTGGTAAT and TACCCTACCGTCTAAAGCTG, respectively, with a C. parvum specific probe 56-FAM/ATCACATTAAATGT/3MGBEc/ with a primer/probe concentration of 300 nM/50 nM [17 (link),18 (link)]. The qPCR consisted of a 95 °C, 5 min hot start followed by 45 cycles of 95 °C for 10 s and 60 °C for 60 s [18 (link)]. Samples were run in triplicate.
4
Rapid PCR Screening for Antibiotic Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA (gDNA) was extracted from pure colonies of the E. coli isolates grown on LB media infused with 1 µg/mL CTX using a commercial DNA extraction kit (ZYMO research Quick-DNA TM Fecal/soil microbe miniprep kit) as per manufacturer’s instructions. PCR was performed on 2 µL extracted gDNA in a total reaction volume of 50 μL consisting of 10 ExTaq PCR buffer, 0.25 μL of ExTaq polymerase, 4 μL each of dNTP, 5 μL of forward and reverse primers (CTX-MA, TEM1 and OXA1) targeted at the blaCTX-M, blaTEM and blaOXA gene, respectively (Appendix A –Table A1 ). The PCR conditions were initial denaturation at 94 °C for 7 min followed by 25 cycles of denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 30 s, with a final extension at 72 °C for 5 min. The amplified PCR products were electrophoresed in 1.5% agarose gel before visualization.
5
Fungal and AMF Community Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The root samples were first chopped and then manually ground using a porcelain mortar and liquid nitrogen. Approximately 0.2 g of the pulverised material was used for DNA-extraction using the Quick-DNATM Fecal/Soil Microbe Miniprep Kit (Zymo Research Europe, Freiburg, Germany) following the manufacturer’s recommendations. Fungal ITS2 regions were amplified following the descriptions in Prada-Salcedo et al. [8 (link)] with primers P5-5/6N-ITS4 (N{5,6}TCCTCCGCTTATTGATATGC) and P7-3/4N-fITS7 (N{3,4}GTGARTCATCGAATCTTTG). AMF SSU regions were amplified following a nested PCR approach [63 ] using the primers GLOMERWT0 (AATARTCAATGCTCTATCCCA) and GLOMER1536 (CGAGDWTCATTCAAATTTCTGCCC), followed by NS31 (TTGGAGGGCAAGTCTGGTGCC) and AML2 (GAACCCAAACACTTTGGTTTCC; see Supplementary Methods S2 ). Libraries were prepared using Illumina Nextera XT and used for paired-end sequencing of 2 × 300 bp with a MiSeq Reagent kit v3 on an Illumina MiSeq platform. The raw Illumina sequences were deposited in the SRA of NCBI under the BioProject accession number PRJNA706719.
6
Hybrid Assembly of E. coli Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using the Quick-DNA TM Fecal/Soil Microbe Miniprep kit according to the manufacturer's instructions (Zymo Research, CA, USA). Whole-genome sequencing was performed using NextSeq 500 (Illumina Inc. San Diego CA USA) and GridION X5 (Oxford Nanopore Technologies, Oxford, UK). The de novo hybrid assembly of both short-reads (NextSeq 500) and long-reads (GridION X5) was performed using Unicycler v0.4.7 under conservative conditions. CheckM v1.0.12 was used to assess the quality of assembled genomes. The allele sequences and sequence types (STs) were determined according to the E. coli database (http://mlst.warwick.ac.uk/mlst/dbs/Ecoli). In the plasmid analysis, Prokka v1.13 was used for genome annotation. Antimicrobial resistance genes were identified using ResFinder v3.2 (https://cge.cbs.dtu.dk/services/ResFinder/). The bacterial insertion sequence was detected using the IS Finder database (https://isfinder.biotoul.fr). PlasmidFinder v2.0.1 was used to determine plasmid incompatibility (Inc) groups. Importing Prokka's annotation result and drawing the plasmid map with Snap Gene v4.3.10 GSL Biotech.
7
Hybrid Assembly of E. coli Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using the Quick-DNA TM Fecal/Soil Microbe Miniprep kit according to the manufacturer's instructions (Zymo Research, CA, USA). Whole-genome sequencing was performed using NextSeq 500 (Illumina Inc. San Diego CA USA) and GridION X5 (Oxford Nanopore Technologies, Oxford, UK). The de novo hybrid assembly of both short-reads (NextSeq 500) and long-reads (GridION X5) was performed using Unicycler v0.4.7 under conservative conditions. CheckM v1.0.12 was used to assess the quality of assembled genomes. The allele sequences and sequence types (STs) were determined according to the E. coli database (http://mlst.warwick.ac.uk/mlst/dbs/Ecoli). In the plasmid analysis, Prokka v1.13 was used for genome annotation. Antimicrobial resistance genes were identified using ResFinder v3.2 (https://cge.cbs.dtu.dk/services/ResFinder/). The bacterial insertion sequence was detected using the IS Finder database (https://isfinder.biotoul.fr). PlasmidFinder v2.0.1 was used to determine plasmid incompatibility (Inc) groups. Importing Prokka's annotation result and drawing the plasmid map with Snap Gene v4.3.10 GSL Biotech.
8
Fungal and AMF Community Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The root samples were first chopped and then manually ground using a porcelain mortar and liquid nitrogen. Approximately 0.2 g of the pulverised material was used for DNA-extraction using the Quick-DNA TM Fecal/Soil Microbe Miniprep Kit (Zymo Research Europe, Freiburg, Germany) following the manufacturer's recommendations. Fungal ITS2 regions were amplified following the descriptions in Prada-Salcedo et al. [10] and AMF SSU regions were amplified following a nested PCR approach [63] (link) (see Supplementary Methods S2). Libraries were prepared using Illumina Nextera XT and used for paired-end sequencing of 2×300 bp with a MiSeq Reagent kit v3 on an Illumina MiSeq platform. The raw Illumina sequences were deposited in the SRA of NCBI under the BioProject accession number PRJNA706719.
9
Gut Microbiome Profiling via qPCR
10
Gut Microbiome Profiling via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The microbial genomic DNA in cecum was extracted from 100 mg of each fecal sample using the Quick-DNATM Fecal/Soil Microbe Miniprep Kit (D6010, Zymo Research, USA) according to the manufacturer’s instructions. The total DNA samples were quantified and assessed purity using NanoDrop™ 2000 spectrophotometers (ThermoFisher Scientific, USA). The amount of total microbiota was estimated by using the universal primers, Uni331F and Uni797R, which amplified a conserved region of the 16 S rRNA for most microbiota. The following representative dominant/subdominant groups from four major phyla of gut microbiota were chosen: Atopobium cluster, Bifidobacterium genus, Bacteroides fragilis group, Clostridium coccoides group, Desulfovibrio genus, Lactobacillus genus, Clostridium leptum group, and Prevotella genus. The specific primers were selected and qPCR assays were performed following the protocols we described previously [10 ].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!