Superreal premix plus sybr green fp205

Total RNA was isolated from LE/6 cell using the TRIzol reagent (Invitrogen, Carlsbad, CA, United States). Two milligram of RNA from each sample was reverse-transcribed with the FastQuant RT Kit (With gDNase) (KR106) (Tiangen, Beijing, China). Real time polymerase chain reaction (PCR) was performed with an ABI ViiA 7 Dx instrument (Applied Biosystems, Foster City, CA, United States) using SuperReal PreMix Plus (SYBR Green) (FP205) PCR reagents (Tiangen, Beijing, China). The fold changes of the target genes were calculated using the 2^-ΔΔCT method. The CTGF primers used for PCR reactions were: forward sequence, 5′- TAGCTGCCTACCGACTGGAA -3′; reverse sequence, 5′- CTTAGAACAGGCGCTCCACT -3′. The GAPDH primers used were: forward sequence, 5′- AGACAGCCGCATCTTCTTGT -3′; reverse sequence, 5′- CTTGCCGTGGGTAGAGTCAT -3′.

Kidney tissues were collected in RNase-free tubes, and total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. For cDNA synthesis, reverse transcription was performed from 2 μg of total RNA using a FastKing RT Kit (Tiangen, KR116). The mRNA expression levels of IL-6, IL-8, TGF-β1, and β-actin were determined using SuperReal PreMix Plus (SYBR Green) (FP205, Tiangen) based on the manufacturer’s instructions. The sequences of the primers used are shown in Table 1. The PCR system consisted of SYBR Green Mix, forward and reverse primers, cDNA, and deionized RNase-free water. PCR was initially denatured at 95°C for 30 s followed by 95°C for 10 s and 65°C for 30 s for 40 cycles and then 81 cycles at 55–95°C for 10 s for melting curve analysis. The comparative gene expression was calculated by the 2^–ΔΔCt method as described previously.