Multiplex cytokine analysis was performed as follows: samples of WT and Tollip−/− mouse bronchoalveolar lavage fluid were thawed on ice and centrifuged at 10,000g for 5–10 minutes to remove particulates. 50μL of each sample was added in triplicate to a 96-well plate. Samples were then added to 50μL of magnetic Simplex beads and incubated with shaking for 1hr at room temperature. Beads were washed 3X and stained with detection antibody cocktail (IFNγ; IL-12p70; IL-13; IL-1β; IL-2; IL-4; IL-5; IL-6; TNF; GM-CSF; IL-18; IL-10; IL-17A; IL-22; IL-23; IL-27; IL-9; GROα; IP-10; MCP-1; MCP-3; MIP-1α; MIP-1β; MIP-2; RANTES; Eotaxin; ThermoFisher Scientific) and incubated with shaking for 30min at room temperature. Beads were washed 3X and incubated with streptavidin-HRP with shaking for 30min at RT. Beads with sample cytokines and detection antibody were resuspended in 120μL of Reading Buffer and cytokine data was acquired immediately on Luminex™ 100/200. Analytes were captured by Ab-coated, fluorochrome-embedded microspheres and detected by biotin-streptavidin-PE using reagents purchased from R&D or Luminex. For single cytokine analysis, concentrations were determined with ELISA (R&D Systems) according to the manufacturer’s instructions.
Rantes
Manufactured by Thermo Fisher Scientific
Sourced in United States
RANTES is a recombinant human chemokine protein that functions as a chemoattractant for T cells, eosinophils, and basophils. It plays a role in inflammatory and immunological processes.
Automatically generated - may contain errors
Lab products found in correlation
Mcp 1, by Thermo Fisher Scientific (6 mentions)
Eotaxin, by Thermo Fisher Scientific (2 mentions)
Ip 10, by Thermo Fisher Scientific (2 mentions)
Mip 1α, by Thermo Fisher Scientific (2 mentions)
Tnf α, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Mouse il 12, by BD (1 mentions)
Mouse il 6, by BD (1 mentions)
Synergy mx, by Agilent Technologies (1 mentions)
Abi 7500 fast rt pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Qiagen (1 mentions)
Met rantes, by R&D Systems (1 mentions)
Pdgf bb, by Thermo Fisher Scientific (1 mentions)
Dulbecco phosphate buffered saline (dpbs), by Thermo Fisher Scientific (1 mentions)
T per, by Thermo Fisher Scientific (1 mentions)
Human rantes, by R&D Systems (1 mentions)
Murine tnfα, by BD (1 mentions)
Sdf 1α, by Thermo Fisher Scientific (1 mentions)
Trucount absolute counting tubes, by BD (1 mentions)
20 protocols using rantes
1
Multiplex Cytokine Profiling of Tollip-Deficient Mice
2
Multiplex Cytokine Profiling of Tollip-Deficient Mice
3
Cytokine and Chemokine ELISA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ELISA was performed to detect the secreted cytokines and chemokines in sera or cell culture supernatants. Mouse IL-6 (BD biosciences, 555240) and mouse IL-12 (BD biosciences, 555165), RANTES (Invitrogen), MCP-1 (Invitrogen) were used for analysis according to the manufacturer’s protocols.
4
Measuring IL-6 and RANTES in LPS-Stimulated iBMDMs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
iBMDMs were seeded at (1 × 105 cells/well) in DMEM + 5 % FBS. The cells were preincubated with PGN derivatives or PGN derivatives/PC mixtures 1 h before LPS stimulation. After 16 h, Il-6 (Bioscience) and RANTES (Invitrogen) concentrations in supernatants were measured by ELISA according to manufacturer’s instructions. Absorbance was measured on SynergyMx (BioTek).
5
Fibroblast Response to Inflammatory Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fibroblasts were cultured in the presence of inflammatory cytokines (TNF‐α or IL‐1β) with or without CM (n = 3 per cell line). A total of 40 000 fibroblasts were seeded per well into 6‐well plates with growth media and cultured overnight under standard culture conditions. Following overnight incubation, growth media were removed and monolayers rinsed with PBS. Fibroblasts were then cultured in assay media alone or in assay media containing TNF‐α or IL‐1β (1 or 0.1 ng/mL) with or without dACM CM (50% vol/vol). The concentrations of inflammatory cytokines used in this study were determined based on existing literature.19 At the end of 96 hours, the supernatant was collected and stored at −80°C. Cell number per well was quantified using AlamarBlue prior to collection with RNAzol for qRT‐PCR. AlamarBlue assays and PCR were conducted as described above. The frozen supernatant was evaluated using ELISAs for production of regulated on activation, normal T cell expressed and secreted (RANTES) and MCP‐1 per the manufacturer's instructions (Invitrogen, Carlsbad).
6
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA from RHE tissues were isolated using TRIzol reagent (Life Technologies, Green Island, NY, USA) according to manufacturer's instructions. RNA was then reverse transcribed to cDNA (Qiagen Inc., Valencia, CA, USA). Real-time PCR was conducted in the ABI 7500 Fast RT PCR system (Applied Biosystems, CA, USA) using SYBR green (Qiagen Inc. CA, USA) and specific primers for IL-8, RANTES, and S100A7 (Invitrogen, Green Island, NY, USA) as per our standardized protocol.[33 (link)] 18S rRNA was used as a reference gene for the real-time PCR assay. The primer sequences are IL-8-forward 5’AGGTGCAGTTTTGCCAAGGA3’; reverse 5’TTTCTGTGTTGGCGCAGTGT3’; RANTES-forward 5’TCCTGCAGAGGATCAAGACA3’; reverse 5’CA ATGTAGGCAAAGCAGCAG3’; S100A7-forward 5’CT TCTACTCGTGACGCTTCC3’; reverse 5’AATTTGT GCC CTTTTTGTCA3’; RN18S1-forward 5’TCAAGAACGA AAGTCGGAGG3’; reverse 5’GGACATCTAAGGGCAT CACA3’.
7
Retrograde Perfusion of Rat Vas Deferens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adult male Sprague-Dawley rats were anesthetized with sodium pentobarbital as described above. The vas deferens was cannulated through the lumen with a micro cannula (0.31 mm OD, 0.16 mm ID; Anilab Software & Instruments Co., PE-0402) connected to a 1-ml syringe. A small incision was made in the distal cauda epididymal region to allow the perfusate to exit the tubule. Perfusion was performed retrogradely at a rate of 20 μl/min using a syringe pump (78-0120S, Stoelting). The lumen was initially washed free of sperm with PBS (0.01M, pH 6.8) for usually 10 min. Then, vas deferens and cauda epididymis were perfused with recombinant RANTES (PeproTech, United States), Met-RANTES (R&D Systems, United States), and PBS of different pH values, respectively. The perfusion was performed retrogradely at a rate of 5 μl/min, and the luminal solution was sustained for 1 h. At the end of the experimental period, the cauda epididymis was harvested and extracted for the RNA and the protein. Or tissues were then washed in PBS, pH 7.4, and perfused with a solution containing 4% paraformaldehyde for 15 min for frozen sections.
8
PBMC Activation by HBsAg and Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Freshly isolated PBMCs from healthy donors were cultured in 96-well plates with 2 μg/ml HBsAg (kindly provided by the Academy of Military Medical Sciences, Beijing) and cytokines at concentrations equivalent to the mean concentrations found in the plasma of CHB patients (IL-8: 40 pg/ml, RANTES: 30 ng/ml, PDGF-BB: 60 ng/ml, IFNγ: 1.5 ng/ml, TNFα: 100 pg/ml, and IP-10: 30 ng/ml) (PeproTech, Rocky Hill, NJ, USA) at a density of 1–1.5 × 106 cells/ml for 20 h. At the end of the culture period, the cells were collected for RNA exaction and real-time PCR.
9
Monocyte Chemotaxis Assay Protocol
10
Chemokine-induced immune response in mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 mice were treated with 60 mg/kg/day Clozapine (kindly supplied by Douglas Pharmaceuticals Ltd. (Auckland, New Zealand)) or vehicle (0.1 M acetic acid) in the drinking water for 7 days. On the following day, mice were injected s.c. with either 10 μg/ml of the chemokine CCL5 (RANTES; Peprotech) or 1 μg/ml of the chemokine CCL2 (MCP-1, Peprotech) in 50 μl dPBS (Invitrogen, USA) into the left hind flanks of the mice, while an equal volume of dPBS (vehicle) was injected into the right hind flank. Eighteen hours following hind flank injections, cells from the draining lymph nodes were isolated, counted, and processed for flow cytometry analysis, as described above.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!