The poly (A) RNAs (300 ng) were spotted onto a nylon membrane (GE Healthcare). The membranes were then UV cross-linked (254 nm), blocked, incubated with m6A antibody (ABE572, 1:1000, Merck Millipore) in 4° Covernight. Antibodies pre-labeled in room temperature for 1 h. The nylon membrane with m6A dots were exposed in visualizer (4600, Tanon, China). The same 300 ng poly (A) RNAs were spotted on the membrane, stained with 0.2% methylene blue in 0.3 M sodium acetate (pH 5.2) for 2 h, and washed with ribonuclease-free water for 1 h.
Abe572
Manufactured by Merck Group
Sourced in United States, Germany, Japan
ABE572 is a laboratory equipment product manufactured by Merck Group. It is designed for specialized tasks within research and analysis workflows. The core function of ABE572 is to provide precise and reliable measurements or processing capabilities to support scientific investigations. No further details about its intended use or specific applications are provided.
Automatically generated - may contain errors
Lab products found in correlation
Novaseq 6000, by Illumina (4 mentions)
Pp64b, by Merck Group (4 mentions)
H00056339 b01p, by Merck Group (3 mentions)
Rneasy micro kit, by Qiagen (3 mentions)
Nylon membrane, by GE Healthcare (2 mentions)
Ecl reagent, by Thermo Fisher Scientific (2 mentions)
Spa 810, by PhosphoSolutions (2 mentions)
Hpa038002, by Santa Cruz Biotechnology (2 mentions)
Sc 374280, by Merck Group (2 mentions)
Alexa fluor 488 donkey anti mouse secondary antibody, by Thermo Fisher Scientific (2 mentions)
Alexa fluor 546 donkey anti rabbit secondary antibody, by Thermo Fisher Scientific (2 mentions)
Ab151230, by Merck Group (2 mentions)
Merip m6a kit, by Merck Group (1 mentions)
Rna purification kit, by Qiagen (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Protein a magnetic beads, by Thermo Fisher Scientific (1 mentions)
Sensifast cdna synthesis kit, by Meridian Bioscience (1 mentions)
Protein g magnetic beads, by Thermo Fisher Scientific (1 mentions)
Bioanalyzer rna 6000 pico kit, by Agilent Technologies (1 mentions)
Bioanalyzer rna 6000 nano kit, by Agilent Technologies (1 mentions)
35 protocols using abe572
1
Quantification of m6A RNA Modifications
2
RNA Modifications in Heat Shock and Hypoxia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rabbit anti-m6A antibody was purchased from EMD Millipore (ABE572). Anti-m7G-cap monoclonal antibody was obtained from MBL (RN016M). HEK293T cells were cultured at 37 °C in DMEM medium supplemented with 10% FBS, 1% GlutaMAX and 0.5% penicillin/streptomycin with 5% CO2. For heat shock, cells were grown to a confluence of 80% in 10-cm plastic dishes, placed in a 43 °C water bath for 2 h, and then recover for 6 h in normal growing conditions. For hypoxia treatment, cells were grown to 80%, carried out in Hypoxia Hood which was maintained at 37 °C, 5% CO2, 1% oxygen for 24 h.
3
Western Blot Analysis of Protein Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-cell lysates and tissue lysates were prepared, and the protein concentrations were determined as previously described42 (link). Whole-cell lysates and tissue lysates were separated using 10–12.5% Tris-SDS-polyacrylamide gel electrophoresis (PAGE) and then electroblotted onto a polyvinylidene fluoride (PVDF) membrane. The indicated proteins were detected using anti-RBRP (our developed, 1:500), Flag (M185-3L, MBL, RRID: AB_11123930, 1:2000), HA (561, MBL, RRID: AB_591839, 1:2000), GFP (50430-2-AP, Proteintech, RRID: AB_11042881, 1:1000), IGF2BP1 (8482, CST, 1:1500), c-Myc (13987, CST, RRID: AB_11179079, 1:1000), m6A (ABE572, Merck Millipore, 1:2000), HuR (11910-1-AP, Proteintech, RRID: AB_11182183, 1:2000), PABPC1 (10970-1-AP, Proteintech, RRID: AB_10596918, 1:2000), MATR3 (12202-2-AP, Proteintech, RRID: AB_2281752, 1:2000), and β-actin (60008-1-Ig, Proteintech, RRID: AB_2289225, 1:4000) antibodies.
4
N6-methyladenosine Enrichment Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from two 15‐cm plates of cell lines infected by lentiviruses with the shRNA using RNAiso plus (#9109, Takara), and the process was completed according to the instructions of Magna methylated RNA immune‐precipitation (MeRIP) m6A Kit (#17–10499, Merck Millipore). In brief, RNA was diluted to 1 μg/μL and sheared into ~100 nt in length. After precipitation at −80°C overnight, nearly 300 μg (except 10% of input) of RNA in 300 μL of RNase‐free water was incubated with magnetic beads loaded with 10 μg of antibody of m6A (#ABE572, Merck Millipore) or immunoglobulin G (IgG) for 2 hours at 4°C. Then, the fragmented RNA containing m6A was eluted and purified with RNA purification kit (#74204, QIAGEN). Enriched fragments were analysed by RT‐qPCR. The primers were designed from the 100 nt around the predicted m6A peak (http://www.cuilab.cn/sramp ) and listed: SETD7 F 5′‐CTGGCTTTGGGGTTCAGAGA‐3′; SETD7 R 5′‐GTCCCATTGTCAGATAAACGTAGTG‐3′; KLF4 F 5′‐CTGTGACTGGATCTTCTATCATTCC‐3′; KLF4 R 5′‐CAGTCACCCCCTTGGCATTT‐3′.
5
m6A Immunoprecipitation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
m6A-IP-Seq was performed as previously described [46 (link)]. Briefly, 5 µg of DNAse treated total RNA were subjected to fragmentation with ZnCl2 incubation at 70 °C for 13 min. Following precipitation, fragmented RNA size distribution was assessed using RNA 6000 Nano Bioanalyzer kit (Agilent). Approximately 500 ng of sample were stored as input control. Fragmented RNA was subjected to two rounds of m6A immunoprecipitation for 2 h each using an anti-m6A antibody (ABE572, Merck) previously conjugated to protein-A magnetic beads (Thermo Fisher Scientific) and protein-G magnetic beads (Thermo Fisher Scientific) by incubation at 4 °C for at least 6 h. Following extensive washing, RNA was eluted from the beads using RLT buffer and RNeasy mini kit (Qiagen). RNA was quantified using RNA 6000 Pico Bioanalyzer kit (Agilent). To confirm m6A enrichment, cDNA was synthesised using the SensiFast cDNA synthesis kit (Bioline) and SETD7 and GAPDH levels measured by qPCR were used as positive and negative control respectively. Finally, library preparation was performed using the SMARTER Stranded Total RNA Seq kit v2-Pico Input Mammalian kit (Takara Bio) following the manufacturer’s instructions. Libraries were then sequenced using HiSeq2500 (Illumina) and a minimum of 20 million paired-end reads were obtained per sample. This experiment was performed in duplicates for each sample.
6
Quantifying m6A RNA Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Poly (A) RNA was spotted on the nylon membrane (GE, USA). Then Membranes were UV cross-linked and blocked for 15 min before incubation with m6A antibody (ABE572, 1:1000, Merck Millipore) overnight at 4 °C. The secondary antibody was incubated for 1 h at room temperature. The cleaned nylon membrane was soaked with ECL reagent (Thermo, USA) for 1 min and visualized using ChemiDoc XRS + imaging system.
7
m6A Regulation of NLRP3 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
m6A modifications on NLRP3 mRNA were detected using the Magna RIP™Quad RNA-binding Protein immunoprecipitation Kit (17–704, Millipore, USA). Briefly, 200 mg of total RNA was enriched with anti-M6A antibody (ABE572, Merck, USA), anti-IGF2BP2 antibody (ab128175, Abcam, USA) or IgG-coupled protein A/G magnetic beads in 500 mL of 1×IP buffer supplemented with RNase inhibitors. Overnight at 4 ° C. The RNA of interest was immunoprecipitated with beads. One-tenth of each RNA fragment was stored as an input control for qPCR analysis with primers: NLRP3, 5′-CCATCAATGCTGCTTCGACA-3′ and 5′-GAGCTCAGAACCAATGCGAG-3′.
8
m6A Immunoprecipitation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For m6A immunoprecipitation, total RNA was first isolated using Trizol reagent followed by fragmentation using freshly prepared RNA fragmentation buffer (10 mM Tris-HCl, pH 7.0, 10 mM ZnCl2). 5 μg fragmented RNA was saved as input control for RNA-seq. 1 mg fragmented RNA was incubated with 15 μg anti-m6A antibody (Millipore ABE572) in 1× IP buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, and 0.1% Igepal CA-630) for 2 hr at 4°C. The m6A-IP mixture was then incubated with Protein A beads for additional 2 hr at 4°C on a rotating wheel. After washing 3 times with IP buffer, bound RNA was eluted using 100 μl elution buffer (6.7 mM N6-Methyladenosine 5′-monophosphate sodium salt in 1× IP buffer), followed by ethanol precipitation. Precipitated RNA was used for cDNA library construction and high-throughput sequencing described below.
9
HeLa and MEF Cells for m6A Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa (cervical cancer) was originally purchased from ATCC and MEF cells were a gift from D.J. Kwiatkowski (Harvard Medical School). Cells were not authenticated recently but tested negative for mycoplasma contamination. Both cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM) with 10% fetal bovine serum (FBS). Antibodies used in the experiments are listed below: anti-YTHDF2 (Proteintech 24744-1-AP, 1:1000 WB, 1:600 IF); anti-Hsp70 (Stressgen SPA-810, 1:1000 WB); anti-FTO (Phosphosolutions 597-Fto, 1:1000 WB, 1:600 IF); anti-METTL3 (Abnova H00056339-B01P, 1:1000 WB, 1:600 IF); anti-METTL14 (sigma HPA038002, 1:1000 WB, 1:600 IF); anti-WTAP (Santa Cruz sc-374280, 1:1000 WB, 1:600 IF); anti-m6A (Millipore ABE572, 1:1000 m6A immunoblotting); Alexa Fluor 488 donkey anti-mouse secondary antibody (Invitrogen A21202. 1:600 IF); Alexa Fluor 546 donkey anti-rabbit secondary antibody (Invitrogen A10040, 1:600 IF).
10
Profiling RNA m6A Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both RNA-seq and m6A-seq procedures have been described previously (44 (link)). For RNA-seq, total RNA was first isolated using TRIzol reagent followed by fragmentation using freshly prepared RNA fragmentation buffer [10 mM tris-HCl (pH 7.0) and 10 mM ZnCl2]. Five-microgram fragmented RNA was saved as input control. For m6A IP, 1-mg fragmented RNA was incubated with 15-μg anti-m6A antibody (Millipore ABE572) in 1× IP buffer [10 mM tris-HCl (pH 7.4), 150 mM NaCl, and 0.1% Igepal CA-630] for 2 hours at 4°C. The m6A-IP mixture was then incubated with protein A beads for additional 2 hours at 4°C on a rotating wheel. After washing three times with IP buffer, bound RNA was eluted using 100-μl elution buffer (6.7 mM N6-methyladenosine 5′-monophosphate sodium salt in 1× IP buffer), followed by ethanol precipitation. Precipitated RNA was used for cDNA library construction and high-throughput sequencing described below.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!