Log In Sign up
The largest database of trusted experimental protocols

Dnase 1

Manufactured by Bio-Rad
Visit Supplier
Sourced in United States, Germany

DNase I is a laboratory enzyme that catalyzes the hydrolysis of DNA, specifically the cleavage of phosphodiester bonds in the DNA backbone. It is commonly used in various molecular biology applications to remove unwanted DNA from samples.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (9 mentions) Iscript cdna synthesis kit, by Bio-Rad (8 mentions) Dnase 1, by New England Biolabs (5 mentions) Dnase 1, by Thermo Fisher Scientific (5 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (4 mentions) Rneasy mini kit, by Qiagen (3 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Iscript reverse transcriptase, by Qiagen (2 mentions) Dnase 1, by Promega (2 mentions) Cfx384 real time pcr detection system, by Bio-Rad (2 mentions) Liberase th, by Merck Group (2 mentions) Mt21020cv, by Thermo Fisher Scientific (2 mentions) Cls430167, by Merck Group (2 mentions) Dmem f12 medium, by Thermo Fisher Scientific (2 mentions) Zombie violet, by BioLegend (2 mentions) Collagenase d, by Roche (2 mentions) Novocyte flow cytometer, by Agilent Technologies (2 mentions) Aurum total rna mini kit, by Bio-Rad (2 mentions) Iq sybr green supermix, by Thermo Fisher Scientific (2 mentions)

Spelling variants of this product

DNase (16 citations) DNase I treatment (2 citations)

30 protocols using dnase 1

1

Transcriptomic Analysis of S. pyogenes

Check if the same lab product or an alternative is used in the 5 most similar protocols
S. pyogenes cells treated with Ct (23.4 µg/mL), Pt (23.4 µg/mL), and Ct + Pt (11.7 + 11.7) µg/mL, or untreated (control), were grown at 37 °C in BHI medium for 24 h. RNeasy Mini kit (Qiagen, Toronto, ON, Canada) was used to process the cell for RNA isolation. The total RNA concentration was determined using a Nano-Quant Plate, TECAN (Infinite M200 PRO, TECAN, Atlanta, GA, USA). The integrity of the isolated RNA was confirmed by running agarose gel electrophoresis. This was followed by the removal of contaminating genomic DNA by the addition of DNase I (Bio-Rad) prior to cDNA synthesis. One microgram of total RNA was taken to synthesize cDNA using an i-Script g DNA clear cDNA Synthesis Kit (Bio-Rad, Mississauga, ON, Canada) as per the manufacturer instructions. The conditions included the following: a cycle of 5 min at 25 °C; 20 min at 46 °C; and 1 min at 95 °C. The freshly prepared cDNA was immediately used for quantitative real-time PCR (qRT-PCR) [54 (link)].
Adil M., Baig M.H, & Rupasinghe H.P. (2019). Impact of Citral and Phloretin, Alone and in Combination, on Major Virulence Traits of Streptococcus pyogenes. Molecules, 24(23), 4237.
+ Open protocol
+ Expand
2

Isolation and Identification of Immune Cells from Popliteal Lymph Nodes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Aseptically removed pLNs were first digested for 30 min in RPMI-1640 media containing 0.2 mg/ml Collagenase IV (Worthington) and 0.1 mg/ml DNase I (BioRad), at 37 °C under constant agitation. The treated pLNs were then gently homogenized using a 1-ml pipette to disrupt the capsule and passage through a 70-μm nylon mesh, centrifuged, and counted using a hemocytometer (Kova International, CA, USA). For cell surface staining, 5 × 106 cells were resuspended in FACS buffer (PBS containing 1% BSA) and treated with 2.4G2 (BD Biosciences) to block Fc receptor at 4 °C for 20 min. Cells were subsequently stained with the following surface markers at 4 °C for 30 min: VioBlue anti-CD11c (REA754, Miltenyi), PerCP Vio700 anti-CD3 (REA606, Miltenyi), PE-anti-B220 (REA755, Miltenyi), PE-Vio615 anti-F4/80 (REA126, Miltenyi), PE Vio770 anti-CD4 (REA604, Miltenyi), APC anti-CD8 (REA601, Miltenyi) and APC Vio770 anti-CD11b (M1/70.15.11.5, Miltenyi). Cells were washed with FACS buffer before acquisition on Attune NxT flow cytometer (ThermoFisher Scientific, USA).
Ku M.W., Authié P., Nevo F., Souque P., Bourgine M., Romano M., Charneau P, & Majlessi L. (2021). Lentiviral vector induces high-quality memory T cells via dendritic cells transduction. Communications Biology, 4, 713.
+ Open protocol
+ Expand
3

Quantitative RT-PCR of Arabidopsis AP1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from 12 day old seedlings was isolated with the Invitrap Plant Spin RNA Mini Kit (Invitek) and treated with DNAseI (Invitrogen). First-strand cDNA was synthesized from 1 µg of DNAseI treated total RNA using the Iscript mix from Biorad in a 20 μl reaction. The cDNA was diluted 20-fold and 4 µl was used for each qPCR reaction. qPCR reactions were run on the BioRAD myIQ system using SYBRgreen (Biorad) in a final volume of 20 µl [PCR program; 3 min. 95 °C, 40 × (15 s 95 °C, 1 min 60 °C)]. The sequences of the forward and reverse qPCR primers used to quantify AP1 are TGCCTCTGGTTTCTCTCCAAAAGC and CGCTATGAGAGGTACTCTTACGCCG, respectively.
Fiers M., Hoogenboom J., Brunazzi A., Wennekes T., Angenent G.C, & Immink R.G. (2017). A plant-based chemical genomics screen for the identification of flowering inducers. Plant Methods, 13, 78.
+ Open protocol
+ Expand
4

Quantifying IL-4 mRNA in THP-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To measure the mRNA levels of IL-4 in THP-1 cells, the RNA was isolated by using a GeneJET RNA purification kit (Thermo Scientific, USA) according to the manufacturer’s protocol. For mycobacterial RNA, Mtb H37Rv cultures grown under different conditions were harvested and resuspended in Trizol (Invitrogen, USA) and lysed using a bead beater for 15 cycles of 1 min pulse and 2 min pause. The lysate was centrifuged at high speed for 10 min at 4°C and processed for RNA isolation following the manufacturer’s protocol. Further, 10 µg of isolated RNA was treated with DNase I (NEB, England) to remove any genomic DNA contamination. 1ug of DNase I treated RNA was converted to cDNA by using the iScript cDNA synthesis kit (BIO-RAD, USA) according to the manufacturer’s protocol. The diluted cDNA was used as the template for the qRT-PCR. The qRT-PCR was performed using the iTaq Universal SYBR green Supermix (BIO-RAD, USA) following the manufacturer’s protocol, in a 96-well plate (Applied Biosystems, USA) and analyzed using QuantStudio3 software.
Yandrapally S., Agarwal A., Chatterjee A., Sarkar S., Mohareer K, & Banerjee S. (2023). Mycobacterium tuberculosis EspR modulates Th1-Th2 shift by transcriptionally regulating IL-4, steering increased mycobacterial persistence and HIV propagation during co-infection. Frontiers in Immunology, 14, 1276817.
+ Open protocol
+ Expand
5

Quantification of BZLF1 Transcript Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
AGS-EBV cells with TRIM33 KO, TRIM24 KO or control KO were harvested from 10-cm dishes and total RNA was extracted using NucleoZOL (Macherey-Nagel) according to the manufacturer’s protocol. One microgram RNA was treated with 0.5 units of DNase I (New England BioLabs) for 15 minutes, followed by one-step real-time quantitative PCR (RT-qPCR) using the Luna Universal One-Step RT-qPCR kit (New England BioLabs) on 1/10th of the DNase I-treated samples in a 10 μl reaction volume using the CFX384 real-time system (Bio-Rad). The primers used for BZLF1 transcript levels and the quantification analysis method was same as described above.
De La Cruz-Herrera C.F., Tatham M.H., Siddiqi U.Z., Shire K., Marcon E., Greenblatt J.F., Hay R.T, & Frappier L. (2023). Changes in SUMO-modified proteins in Epstein-Barr virus infection identifies reciprocal regulation of TRIM24/28/33 complexes and the lytic switch BZLF1. PLOS Pathogens, 19(7), e1011477.
+ Open protocol
+ Expand
6

Immune Activation Protocol Reagents

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The following chemicals and drugs were utilized in this study: Talabostat/VbP (MCE #HY-13233A), Lipofectamine 2000 (Invitrogen #11668019), double-stranded alternating copolymer poly(dA:dT) (pdAdT) (Sigma #P0883), poly(I:C) (pIC) (Invivogen #tlrl-picw), HT-DNA (Sigma #D6898), double-stranded homopolymer poly(dA):poly(dT) (Sigma #P9764), poly(dG:dC) (Invivogen #tlrl-pgcn), PAM3CSK4 (Invivogen #tlrl-pms), nigericin (Sigma #N7143), diABZI (MCE #HY-112921B), ANS (MCE #HY-18982), H2O2 (Sigma #H1009), MG-132 (MCE #HY-13259), Bortezomib (MCE #HY-10227), MCC950 (Invivogen #inh-mcc), z-VAD-FMK (Santa Cruz #sc-3067), z-DEVD-FMK (Santa Cruz #sc-311558), H-151 (MCE #HY-112693), NAC (Sigma #A9165), KU-44933 (Santa Cruz #sc-202963), NU-7441 (Tocris #3712), Sorafenib (Sigma #SML2633), PLX-4720 (MCE #HY-51424), Doramapimod (MCE #HY-10320), SB-202190 (MCE #HY-10295), and RNA Polymerase III inhibitor (Sigma #557403). gDNA was isolated from the genomic DNA of HEK293T cells. ISD was synthesized from custom oligos as previously described (55 (link)). Recombinant IFNγ was purchased from Peprotech (#300-02). DNase I (Bio-Rad #7326828), S1 Nuclease (Thermofisher #EN0321), and RNase A/T1 Cocktail (Thermofisher #AM2286) were purchased from the indicated vendors. VACV Copenhagen strain WT and ΔF1L were a kind gift of John Bell (56 (link)) and titered by plaque assay.
Zhou J.Y., Sarkar M.K., Okamura K., Harris J.E., Gudjonsson J.E, & Fitzgerald K.A. (2023). Activation of the NLRP1 inflammasome in human keratinocytes by the dsDNA mimetic poly(dA:dT). Proceedings of the National Academy of Sciences of the United States of America, 120(5), e2213777120.
+ Open protocol
+ Expand
7

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from limb bud micromasses or primary
chondrocytes (collected one day after plating, passage 0) using TRIzol reagent
(Invitrogen). Samples of one microgram were treated with DNaseI (BioRad), then
reverse transcribed using iScript Reverse Transcriptase (Qiagen). 20ng of cDNA
was used for quantitative PCR analyses. Quantitative PCR was performed using
SYBR Green I Mastermix (Roche) and run on a BioRad CFX96 Touch Real-Time PCR
Detection System. Relative expression of mRNA was calculated relative to
β-actin by comparative cycle threshold analyses.
Gene expression values are expressed as 2ΔΔCt, with
ΔΔCt defined as the difference in crossing
threshold (Ct) values between wild type and mutant samples, using
β-actin as an internal standard. Murine
oligonucleotide primer sequences were as listed in Table 1.
For western blotting, cells were scraped in RIPA lysis buffer
supplemented with protease inhibitor cocktail (Sigma-Aldrich). 30 ug of total
protein was loaded per well of 12% acrylamide SDS-PAGE gel. Western blotting was
performed using anti-histone H3 dimethyl K79 (H3K79me2, Abcam #ab3594, 1:750
dilution), anti-β-actin antibody (Cell Signaling, #3700, 1:2000
dilution). Detection and analyses was performed using Bio-Rad ChemiDoc XRS+
imager and Image Lab software 4.1.
Sutter P., Karki S., Crawley I., Singh V., Bernt K.M., Rowe D., Crocker S.J., Bayarsaihan D, & Guzzo R.M. (2020). Mesenchyme-specific loss of Dot1L histone methyltransferase leads to skeletal dysplasia phenotype in mice. Bone, 142, 115677.
+ Open protocol
+ Expand
8

Quantitative RT-PCR Analysis of Mouse and Human Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs from mouse tissues and crypt cells were purified using TRIzol reagent (Invitrogen) followed by DNaseI (Promega) digestion. Equal quantities of DNaseI-treated RNA were reverse transcribed using an iScript cDNA synthesis kit (Bio-Rad). The cDNAs were subjected to conventional PCR method or real-time qPCR. The qPCR reactions were amplified and analyzed in triplicate using CFX384 Real-Time PCR detection system (Bio-Rad). All experiments were repeated twice. Primers and annealing temperatures (Ta) used for amplification were listed in Supplemental Experimental Procedures (Table S1). A detailed description of quantitative RT-PCR (qRT-PCR) on human intestinal organoids was provided in the Supplemental Experimental Procedures.
Chen Y.J., Finkbeiner S.R., Weinblatt D., Emmett M.J., Tameire F., Yousefi M., Yang C., Maehr R., Zhou Q., Shemer R., Dor Y., Li C., Spence J.R, & Stanger B.Z. (2014). De Novo Formation of Insulin-Producing “Neo-β Cell Islets” from Intestinal Crypts. Cell reports, 6(6), 1046-1058.
+ Open protocol
+ Expand
9

Quantitative RT-PCR Analysis of Mouse and Human Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs from mouse tissues and crypt cells were purified using TRIzol reagent (Invitrogen) followed by DNaseI (Promega) digestion. Equal quantities of DNaseI-treated RNA were reverse transcribed using an iScript cDNA synthesis kit (Bio-Rad). The cDNAs were subjected to conventional PCR method or real-time qPCR. The qPCR reactions were amplified and analyzed in triplicate using CFX384 Real-Time PCR detection system (Bio-Rad). All experiments were repeated twice. Primers and annealing temperatures (Ta) used for amplification were listed in Supplemental Experimental Procedures (Table S1). A detailed description of quantitative RT-PCR (qRT-PCR) on human intestinal organoids was provided in the Supplemental Experimental Procedures.
Chen Y.J., Finkbeiner S.R., Weinblatt D., Emmett M.J., Tameire F., Yousefi M., Yang C., Maehr R., Zhou Q., Shemer R., Dor Y., Li C., Spence J.R, & Stanger B.Z. (2014). De Novo Formation of Insulin-Producing “Neo-β Cell Islets” from Intestinal Crypts. Cell reports, 6(6), 1046-1058.
+ Open protocol
+ Expand
10

RNA Extraction and Purification Protocol

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated by following the protocol previously described [4 (link)]. The isolated RNA was purified using Bio-Rad spin column (Cat. No. 732–6250, Bio-Rad, Hercules, CA) and treated with DNase I (Cat. No. R1013, Zymo Research, Irvine, CA) to remove any genomic DNA contamination. The integrity and quality of RNA samples were analyzed on Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA) using RNA 6000 Pico kit (Cat. No. 5067–1513, Agilent Technologies, Santa Clara, CA). Bacterial rRNAs were removed using Life technologies MICROBExpress kit (Cat. No. AM1905, Grand Island, NY) and the extent of the removal of rRNA from the samples was analyzed on Agilent Bioanalyzer 2100.
Shanmugam M., El Abbar F, & Ramasubbu N. (2015). Transcriptome Profiling of Wild-Type and pga-Knockout Mutant Strains Reveal the Role of Exopolysaccharide in Aggregatibacter actinomycetemcomitans. PLoS ONE, 10(7), e0134285.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!