Inhibitor nc

MiR-92a-3p mimics, inhibitor, mimics NC, and inhibitor NC were obtained from GenePharma (Shanghai, China). The MiR-92a-3p mimics sequences were: 5′-UAUUGCACUUGUCCCGGCCU-3′ and the corresponding negative control (mimics NC) sequences: 5′-UUCUCCGAACGUGUCACGUTT-3′. The miR-92a-3p inhibitor sequences: 5′-CAGGCCGGGACAAGUGCAAUA-3′ and the corresponding negative control (inhibitor NC) sequences: 5′-CAGUACUUUUGUGUAGUACAA-3′. The GP-transfect-Mate (GenePharma, Shanghai, China) was used to transfect cells. The cells were incubated at 1 × 10⁵ cells/well in six-well cell culture plates, and were grown to 60%–70% confluence. The MiR-92a-3p mimics (mi92, 50 nM), inhibitor (in92, 50 nM), inhibitor NC (inNC, 50 nM) and mimics NC (miNC, 50 nM) were added directly to the cells. The cells were assigned randomly to 7 groups: control, OGD, miNC, inNC, mi92, mi92 + M, in92. The miNC, inNC, mi92, and in92 groups were transfected respectively. The mi92 + M group was transfected respectively for 6 h, and then intervention with 19 μmol/L AA for 24 h. The group details and process are displayed in Figure 1C. After transfection, the OGD, miNC, inNC, mi92, mi92 + M, and in92 groups were followed by stimulation with OGD, respectively. Cell viability and expressions of TJ proteins were quantified.

For regulation of miR-93-5p expression level, miR-93-5p mimics, miR-93-5p inhibitors, NC mimics and NC inhibitors were designed and provided by GenePharma (Shanghai, China). To knock down or over expressed TLR4 expression, the siRNAs against TLR4 and over expressed TLR4 were obtained from Generalbio (Anhui, China) with nonspecific siRNAs and vector as negative control. The siRNAs sequences were as follows: miR-93-5p inhibitor, AGGTAGTGTGATTACCCAACCTACT; Si-TLR4, CACGGCATCTTTACTGGCTTAGTCA. Cells were plated to 6-well plates at 4 × 10⁵ cells/well and transfected with the mentioned plasmids or oligonucleotides using Lipofectamine 3000 (Thermo Fisher Scientific, USA) obeying the manufacturer’s directions.

Specific shRNAs against LINC00689 (sh-LINC00689#1 and sh-LINC00689#2) and their corresponding NC (sh-NC), as well as the pcDNA3.1 vector containing the whole sequence of LINC00689 or CTNNB1 and the empty vector, were attained from Genechem (Shanghai, China). The miR-496 mimics, miR-496 inhibitors, NC mimics and NC inhibitors were constructed by GenePharma (Shanghai, China). By use of Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA), plasmids mentioned were individually transfected into DU145 or LNCaP cells in 24-well plates for 48 h. Sequences for shRNAs were listed as follows: sh-NC: CCGG TCTTGCGTCGTCTGTCTATAC CTCGAG GTATAGACAGACGACGCAAGA TTTTTG; sh-LINC00689#1: CCGG GCGTCTTTCCTTCTGTTAAGC CTCGAG GCTTAACAGAAGGAAAGACGC TTTTTG; CCGG GCTTCTGCTTTCCTGAAATTC CTCGAG GAATTTCAGGAAAGCAGAAGC TTTTTG. Plasmids’ sequences were shown as follows: NC mimics: gcugcauaucaguaucuacaug; miR-496 mimics: ugaguauuacauggccaaucuc; NC inhibitors: uagacaggcauguaauguacuc; miR-496 inhibitors: gagauuggccauguaauacuca.

Human HSCC cell line FaDu was purchased from Chinese Academy of Sciences (Shanghai, China), and the cells were cultured in DMEM medium containing 10% FBS. The siRNA-NC, siRNA-LEF1-AS1, NC mimics, NC inhibitors, miR-221-5p mimics, and miR-221-5p inhibitors were all purchased from Genepharma (Shanghai, China) for transfection by using Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific).

Four human CRC cell lines (HT29, LOVO, SW480 and PKO) and a normal human colon epithelial cell line NCM460 were purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI1640 medium (Gibco, Carlsbad, CA, USA), and were supplemented with 10% fetal bovine serum (FBS, Gibco, NY, USA). All cell lines were cultured at a condition of 37°C with a humidified atmosphere containing 5% CO₂18 (link). Specific shRNAs against DSCAM-AS1 (sh-DSCAM-AS1#1 and sh-DSCAM-AS1#2) and corresponding NCs (sh-NCs), together with the pcDNA3.1 vector targeting Notch-1 and the empty vector, were acquired from RiboBio (Guangzhou, China). Moreover, miR-137 mimics, miR-137 inhibitors, NC mimics and NC inhibitors were acquired from GenePharma (Shanghai, China). HT29 or LOVO cells were transfected with these plasmids through Lipofectamine 2000 (Invitrogen, CA, USA), separately.