DNA from the stool samples was isolated with the aid of a MagnaPure Compact System (Roche Life Science, Mannheim, Germany) to avoid bias in the DNA purification toward the misrepresentation of Gram-positive bacteria, following the Yuan et al., method [29 (link)]. For high-throughput sequencing, the hypervariable region of V3-V4 of the bacterial 16s ribosomal RNA gene was amplified using key-tagged eubacterial primers [30 (link)] and sequenced with a MiSeq Illumina Platform (Illumina, San Diego, CA, USA). The Illumina recommendations for library preparation and sequencing for metagenomics studies were used. The bacterial compositions of all the patients were compared with a group of healthy diet-matched individuals selected from the healthy partners living with them.
Magna pure compact system
Manufactured by Roche
Sourced in Germany, Switzerland, United States
The MagNA Pure Compact System is an automated nucleic acid extraction and purification instrument designed for use in clinical and research laboratories. It utilizes magnetic bead-based technology to extract and purify DNA, RNA, and viral nucleic acids from a variety of sample types. The system's core function is to provide a standardized and consistent method for nucleic acid isolation and preparation, ensuring high-quality samples for downstream applications such as PCR, sequencing, and other molecular analyses.
Automatically generated - may contain errors
Lab products found in correlation
Magna pure compact nucleic acid isolation kit, by Roche (8 mentions)
Magna pure compact nucleic acid isolation kit 1, by Roche (4 mentions)
Miseq platform, by Illumina (3 mentions)
Magna pure compact rna kit, by Roche (3 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (3 mentions)
Qubit rna br assay kit, by Thermo Fisher Scientific (3 mentions)
Nucleic acid isolation kit 1, by Roche (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Miseq system, by Illumina (2 mentions)
Lightcycler 2, by Roche (2 mentions)
Abi prism 3730xl dna analyzer, by Thermo Fisher Scientific (2 mentions)
Pcr fragment extraction kit, by Geneaid (2 mentions)
Magna lyser device, by Roche (2 mentions)
Magna lyser, by Roche (2 mentions)
Cobas 6800 system, by Roche (2 mentions)
Cobas omni lysis reagent, by Roche (2 mentions)
Rotor gene q, by Qiagen (2 mentions)
Magna pure compact rna isolation kit, by Roche (2 mentions)
Magna lyser instrument, by Roche (2 mentions)
69 protocols using magna pure compact system
1
Gut Microbiome Profiling of Stool Samples
2
Quantitative PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total cellular RNA was extracted using the MagNA Pure Compact System (Roche). The quantity of RNA was determined using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). RNA samples were reverse-transcribed for 120 min at 37 °C with the High Capacity cDNA Reverse Transcription Kit according to the manufacturer’s instructions (Applied Biosystems). QPCR was performed using the 2 × Power SYBR Green PCR Master Mix (Applied Biosystems) and 200 nM forward and reverse primers under the following conditions: 10 min at 95 °C, 40 cycles of 15 s at 95 °C, and 1 min at 60 °C. The used primer sequences are as follows: forward 5′-GAACAGCACCGGGCTGAA-3′ and reverse 5′-TAACGACGCCGCATCAAGT-3′ for ycbS and forward 5′-ATACCGCATAACGTCGCAAGA-3′ and reverse 5′-GTGAGCCGTTACCCCACCTA-3′ for 16S rRNA. Each assay was run in triplicate on an Applied Biosystems 7300 Real-Time PCR system (Applied Biosystems), and expression fold changes were derived using the comparative CT method. Moreover, 16S rRNA was used as the reference gene to normalise specific gene expression in each sample.
3
Total RNA Extraction and RNA-Seq Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from PBMCs with the MagNA Pure Compact System (Roche Diagnostics GmbH, Germany) following the manufacturer's recommendations. Library constructions were performed on VAHTS Total RNA-Seq (H/M/R) Library PrepKit for Illumina and sequencing were performed on Illumina HiSeq 2500 platform according to the manufacturer's specifications. The RNA expression matrix was imported into R software, and the limma package was used for DEGs analysis to identify differentially expressed genes. The identified DEGs were imported into the HiPlot online tool to draw a volcano plot.
4
Adipogenic Gene Expression Analysis in ADSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from a cell pellet of ADSCs, either predifferentiation or
postdifferentiation to mature adipocytes, using the MagNA Pure Compact system
(Roche, Penzburg Germany). Once extracted, RNA concentration and integrity were
measured using the NanoDrop® ND-1000 Spectrophotometer (NanoDrop
Technologies Inc, Wilmington, DE, USA). For cDNA synthesis, aliquots of total
RNA equivalent to 1 µg were reverse transcribed using SuperScript III Reverse
Transcriptase enzyme (Invitrogen, Carlsbad, CA, USA). Polymerase chain reaction
(PCR) was the technique used to amplify DNA across several orders of magnitude,
generating multiple copies of a specific DNA sequence. The real-time qualitative
polymerase chain reaction (RQ-PCR) instrument used was the ABI Prism®7000 Sequence Detection System (Applied Biosystems, Foster City California). The
genes investigated were adipogenic genes—lipoprotein lipase (LPL), peroxisome
proliferator-activated receptor gamma (PPAR-γ), and fatty-acid-binding protein 4
(FABP4).
postdifferentiation to mature adipocytes, using the MagNA Pure Compact system
(Roche, Penzburg Germany). Once extracted, RNA concentration and integrity were
measured using the NanoDrop® ND-1000 Spectrophotometer (NanoDrop
Technologies Inc, Wilmington, DE, USA). For cDNA synthesis, aliquots of total
RNA equivalent to 1 µg were reverse transcribed using SuperScript III Reverse
Transcriptase enzyme (Invitrogen, Carlsbad, CA, USA). Polymerase chain reaction
(PCR) was the technique used to amplify DNA across several orders of magnitude,
generating multiple copies of a specific DNA sequence. The real-time qualitative
polymerase chain reaction (RQ-PCR) instrument used was the ABI Prism®7000 Sequence Detection System (Applied Biosystems, Foster City California). The
genes investigated were adipogenic genes—lipoprotein lipase (LPL), peroxisome
proliferator-activated receptor gamma (PPAR-γ), and fatty-acid-binding protein 4
(FABP4).
5
Genomic DNA Extraction Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two different protocols were used for the isolation of genomic DNA. Manual RFLP-grade DNA extraction was performed, as previously described [36 (link)].
An automated DNA extraction was performed by suspending a confluent portion of bacteria from LJ media in 400 µL TE, heat inactivated for 30 min at 90 ℃ followed by incubation with 1 mg/mL lysozyme at 37 ℃ overnight. An amount of 400 µL of the bacterial lysate was transferred to the automated MagNA Pure Compact system for DNA extraction according to the manufacturer’s instructions (Roche Life Science, Penzberg, Germany).
An automated DNA extraction was performed by suspending a confluent portion of bacteria from LJ media in 400 µL TE, heat inactivated for 30 min at 90 ℃ followed by incubation with 1 mg/mL lysozyme at 37 ℃ overnight. An amount of 400 µL of the bacterial lysate was transferred to the automated MagNA Pure Compact system for DNA extraction according to the manufacturer’s instructions (Roche Life Science, Penzberg, Germany).
6
HLA Genotyping by NGS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were referred to the National Histocompatibility and Immunogenetics Reference Laboratory (NHIRL) at the Irish Blood Transfusion Service for genetic testing. Using the MagNA Pure Compact System (Roche, Germany), DNA was extracted according to the manufacturer’s instructions. All samples were genotyped at the 11 HLA loci (A, B, C, DRB1, DRB3/4/5, DQA1, DQB1, DPB1, DPA1) by Next Generation Sequencing (NGS) on the illumina MiSeq System (illumina, USA) using the AllType NGS 11-loci amplification kit (One Lambda, USA), according to the manufacturer’s instructions. The final HLA genotypes were assigned using TypeStream Visual (TSV) NGS Analysis Software version 1.3 (One Lambda).
7
Molecular Diagnosis of Mycoplasma pneumoniae and Respiratory Viruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pharyngeal swabs to assess Mp infection were subjected to DNA isolation using automated MagNA Pure Compact System (Roche Diagnostics, Mannheim, Germany) and the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics, Mannheim, Germany). Mp real-time PCR was performed using the commercially available kit Chla/Myco pneumo r-gene (Argene BioMerieux diagnostics, Marcy l’Etoile, France) on a LightCycler 2.0 (Roche Diagnostics, Mannheim, Germany) platform according to the manufacturer’s instructions. Macrolide resistance was recognized by pyrosequencing two parts of domain V in the 23S rRNA gene [10 (link)].
Multiplex PCR using Respiratory Viruses 16-Well Assay V.17 (AusDiagnostics, Mascot, Australia) was performed on the nasopharyngeal swab specimens to assess viral co-detection, including respiratory syncytial virus, influenza virus, parainfluenza virus, human bocavirus, adenovirus, metapneumovirus, rhinovirus, enterovirus, and human coronavirus [11 (link)].
Multiplex PCR using Respiratory Viruses 16-Well Assay V.17 (AusDiagnostics, Mascot, Australia) was performed on the nasopharyngeal swab specimens to assess viral co-detection, including respiratory syncytial virus, influenza virus, parainfluenza virus, human bocavirus, adenovirus, metapneumovirus, rhinovirus, enterovirus, and human coronavirus [11 (link)].
8
EGFR Mutation Detection Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted by using the MagNA Pure Compact Nucleic Acid Isolation Kit on the MagNA Pure Compact System (Roche, Pleasanton, CA, USA). The primers used were EGFR-C797-F: CATTCATGCGTCTTCACCTG and EGFR-C797-R: TTATCTCCCCTCCCCGTATC. The target sequences were amplified by a KAPA HiFiHotStart PCR kit (KAPA Biosystems, Pleasanton, CA, USA). The reaction mixtures were run in a 9700 thermal cycler (Applied Biosystems) using the following cycling reactions: 3 min at 95 °C, followed by 25 cycles of 20 s at 95 °C, 20 s at 66 °C, and 30 s at 72 °C, with a final hold at 4 °C. The PCR amplicons were checked by 1.5% agarose gel electrophoresis. The amplicons were purified by using a PCR Fragment Extraction Kit (Geneaid, Taiwan). DNA sequencing was performed using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v3.1 (Applied Biosystems) and the ABI PRISM 3730XL DNA Analyzer.
9
Transcriptomic Analysis of Frozen Tumor Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples of frozen tumor tissues were first homogenized using a MagNA Lyser device (Roche, Basel, Switzerland). Subsequent total RNA isolation was performed using the MagNA Pure Compact RNA Kit (Roche) on the MagNA Pure Compact System (Roche) according to the manufacturer’s protocol. The concentration of isolated total RNA was assessed on a Qubit 4.0 fluorimeter (Thermo Fisher Scientific, Waltham, MA, USA) using the Qubit RNA BR Assay Kit (Thermo Fisher Scientific). The RIN (RNA integrity number) parameter, which characterizes the integrity of RNA, was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The RIN for all samples studied was no less than 7.
Sample preparation of mRNA libraries was performed using the TruSeq Stranded mRNA Kit (Illumina, San Diego, CA, USA) as described previously [35 (link)]. The size of the resulting mRNA library was ~260 bp.
High-throughput sequencing of mRNA libraries was performed on a NextSeq 500 System (Illumina) using NextSeq 500/550 High Output Kit v2.5 (Illumina) in 75 bp single-ended read mode. On average, about 20 million reads were received for each sample.
Sample preparation of mRNA libraries was performed using the TruSeq Stranded mRNA Kit (Illumina, San Diego, CA, USA) as described previously [35 (link)]. The size of the resulting mRNA library was ~260 bp.
High-throughput sequencing of mRNA libraries was performed on a NextSeq 500 System (Illumina) using NextSeq 500/550 High Output Kit v2.5 (Illumina) in 75 bp single-ended read mode. On average, about 20 million reads were received for each sample.
10
Rapid DNA Extraction from Rectal Swabs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted by first mixing 100 µL of the suspended rectal swabs with 900 µL TE buffer in order to avoid quantitative PCR (qPCR) inhibition. The mixture was heated to 95 °C for 20 min, followed by mechanical lysis at 7000 rpm for 70 s using a MagNa Lyser (Roche®, Mannheim, Germany). DNA was then extracted using the MagNA Pure Compact system (Roche®, Mannheim, Germany) and stored at −20 °C until used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!