ChIP reactions were performed as previously described (Jimeno-Gonzalez et al. 2006 (link)) by cross-linking with 1% formaldehyde for 20 min at room temperature. IPs were carried out using the following reagents: Rpb1p, Sepharose–protein A beads (GE Healthcare) and the rabbit polyclonal antibody Rpb1-y80 (Santa Cruz Biotechnology); Rpb3, Dynabeads M-280 sheep anti-Mouse IgG (Invitrogen) and the mouse monoclonal antibody anti-POLR2C (Abcam); Rat1-TAP, Sepharose-IgG beads (GE Healthcare); Rpb1p CTD-Ser2P, Dynabeads M-280 sheep anti-Mouse IgM (Invitrogen) and the mouse monoclonal antibody H5 (Covance); Fcp1-myc, Dynabeads M-280 sheep anti-Mouse IgG (Invitrogen) and the mouse monoclonal antibody c-myc (Santa Cruz); and Ctk1-HA, Dynabeads M-280 sheep anti-Mouse IgG (Invitrogen) and the mouse monoclonal antibody anti-HA (Santa Cruz). Purified DNA was analyzed as previously described (Jimeno-Gonzalez et al. 2010 (link)). Oligonucleotide sequences used for qPCR analysis of the GAL-YLR454W reporter gene are described by Jimeno-Gonzalez et al. (2010) (link) and for PMA1 are as follows: 5, TCAGCTCATCAGCCAACTCAAG and CGTCGACACCGTGATTAGATTG; middle, TTGCCAGCTGTCGTTACCAC and TCGACACCAGCCAAGGATTC; 3′ UTR, TCTCTGGATGGTACTTTTTCTTTCTTG and TGCGTGTTGTGAATTGTGCTC; and T1, GCGCCCATACAGACA and CTTGTAGAATGGCCT.
Dynabeads m 280 sheep anti mouse igg
Manufactured by Thermo Fisher Scientific
Sourced in United States
Dynabeads M-280 sheep anti-mouse IgG are uniform, superparamagnetic polystyrene beads with a diameter of 2.8 μm. The beads are coated with sheep polyclonal antibodies against mouse immunoglobulin G (IgG).
Automatically generated - may contain errors
Lab products found in correlation
Dynabeads m 280 sheep anti rabbit igg, by Thermo Fisher Scientific (4 mentions)
Protease inhibitor cocktail, by Roche (4 mentions)
Myc monoclonal antibody, by Thermo Fisher Scientific (3 mentions)
Ab1791, by Abcam (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Minelute kit, by Qiagen (2 mentions)
Bioruptor, by Diagenode (2 mentions)
Ultraflextreme, by Bruker (2 mentions)
Protease inhibitor cocktail, by Merck Group (2 mentions)
Dynabeads protein a, by Thermo Fisher Scientific (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Sds sample buffer, by Bio-Rad (2 mentions)
Polyjet in vitro dna transfection reagent, by SignaGen (2 mentions)
Magnetic separator, by Thermo Fisher Scientific (2 mentions)
Irdye 800cw goat anti rabbit, by LI COR (1 mentions)
Immobilon fl pvdf membrane, by Merck Group (1 mentions)
Anti sprouty2 60719, by Cell Signaling Technology (1 mentions)
Anti flag, by Cell Signaling Technology (1 mentions)
Odyssey fc imaging system, by LI COR (1 mentions)
Odyssey blocking buffer, by LI COR (1 mentions)
53 protocols using dynabeads m 280 sheep anti mouse igg
1
ChIP-qPCR Analysis of RNA Polymerase
2
Chromatin Immunoprecipitation (ChIP) Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was conducted as previously described18 (link). For ChIP-qPCR experiments (see below) a 10 min crosslinking time was used for both the FLAG M1 antibody (overexpression experiments) and SETX antibody. Sonication was performed in a refrigerated Bioruptor (Diagenode) and conditions were optimized to generate DNA fragments of approximately 200–1000 bp. Lysates were pre-cleared with the appropriate isotype control for 3 hours. Specific antibodies (Ab) were coupled with anti-mouse- (Dynabeads® M-280 Sheep Anti-Mouse IgG, Invitrogen 112-02), or anti-rabbit IgG bound magnetic beads (Dynabeads® M-280 Sheep Anti-Mouse IgG, Invitrogen, 112-04) for 6 hours. Antibody bound beads and chromatin were then immunoprecipitated at 4°C rotating overnight. After the wash steps, reverse crosslinking was carried out at 65°C overnight. ChIP DNA was then isolated after RNase digestion and proteinase K digestion, using the QIAGEN MinElute kit (QIAGEN, 28004) and used for downstream applications. Statistical significance of ChIP qPCR analysis was determined using two-tailed Student’s paired t-test.
3
Chromatin Immunoprecipitation (ChIP) Protocol
4
Sprouty2 Immunoprecipitation and Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For immunoprecipitation total cell lysates (TCL) of U251 cells stably overexpressing Sprouty2-FLAG were prepared followed by sonication and centrifugation. Dynabeads™ M-280 Sheep anti-mouse IgG (Invitrogen, Carlsbad, CA, USA ) was conjugated with anti-FLAG (Cell signaling #8146, 1:50) overnight at 4°C. Protein lysates were incubated with anti-FLAG-conjugated beads for 1 h at 4°C. After three washes beads were boiled in loading buffer and analyzed together with TCL by immunoblotting (IB). TCL were prepared followed by sonication and boiling. Equal amounts of proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to Immobilon-FL-PVDF membrane (Millipore). Membranes were blocked with Odyssey® blocking buffer (LI-COR Biosciences) in PBS and incubated with primary antibodies (Abcam: anti-Sprouty2 #60719, 1:500; Cell Signaling: anti-GAPDH #5174, 1:1,000; anti-tubulin #2128, 1:1,000; anti-vimentin #5741, 1:1,000; anti-FLAG #8146, 1:1,000). The secondary fluorescent-linked antibodies (IRDye® 680RD goat anti-mouse and IRDye® 800 CW goat anti-rabbit, 1:20,000; LI-COR Biosciences) were detected by the Odyssey FC Imaging System (LI-COR Biosciences).
5
Peroxiredoxin-1 Chaperone Activity Assay
6
ChIP-qPCR Profiling of Histone Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed as described previously54 (link). 1.5 × 108 cells from log-phase cultures in YE media supplemented with leucine, uracil, adenine, and histidine (YE4S) were collected by centrifugation, and suspended in 60 mL of EMM. After the addition of formaldehyde (Sigma-Aldrich, F8775) to a final concentration of 1%, the cell suspension was vigorously mixed for 15 min at room temperature. The cell suspension was further mixed for 5 min, after the addition of 3 mL of 2.5 M glycine to neutralize the crosslinker. Mouse antibodies against H3K9me297 (link), H3K9me397 (link), H3K9ac98 (link), H3K14ac98 (link), Rpb1 (Millipore, CTD4H8, 05-623), and FLAG (Sigma-Aldrich, F1804), and rabbit antibodies against histone H3 (Abcam, ab1791) were used. Mouse and rabbit antibodies were attached to Dynabeads M-280 sheep anti-Mouse IgG (Invitrogen, 11202D) and Dynabeads M-280 sheep anti-Rabbit IgG (Invitrogen, 11204D), respectively. DNAs in whole-cell extracts and immunoprecipitates were quantified by real-time PCR using SYBR FAST (Thermo Fisher, 4385614) in a StepOnePlus real-time PCR system (Applied Biosystems). The primers used in ChIP are listed in Supplementary Table 3 .
7
Immunoprecipitation of Aβ peptide from conditioned media
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunoprecipitation (IP) of conditioned cell media from transiently transfected HEK293T cells was performed using the method described previously with minor modifications [41 (link)]. In brief, 4 µg of antibodies 6E10 and 4G8 (BioLegend) were conjugated separately with Dynabeads M-280 Sheep Anti-Mouse IgG (Invitrogen) through an incubation period of one hour at room temperature. Phosphate buffered saline (PBS) was used as negative control and pooled human CSF was used as positive control. Cell media samples and the control samples were incubated overnight at 4 °C with 50 µl of the antibody-conjugated beads in the presence of 0.2% (w/v) Triton X-100 (Sigma Aldrich). King Fisher magnetic particle processor (Thermo Scientific) was used for automated elution of Aβ peptide consisting of sequential washes in 0.2% Triton X-100, PBS and 50 mM ammonium bicarbonate. The final eluates were collected in 100 µl 0.5% (v/v) formic acid (Fluka), dried in a vacuum centrifuge and kept at − 80 °C.
8
Chromatin Immunoprecipitation Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed using ChIP-IT Express Kit (Active Motif) according to the manufacturer’s instructions with minor modifications. Briefly, the fixed cells were lysed and chromatin was sheared using an enzymatic shearing cocktail for 10 min at 37 °C. The sheared chromatin was mixed with 3 μg of antibody and 40 μL of magnetic beads (Dynabeads M-280 sheep anti-mouse IgG or Dynabeads ProteinG (Invitrogen)) and incubated with rotation at 4 °C overnight. After IP, DNA was recovered by incubation with elution buffer (10% SDS, 300 mM NaCl, 10 mM Tris–HCl, and 5 mM EDTA, pH 8.0) at 65 °C for 6 h. Recovered DNA was purified using ChIP DNA Clean and Concentration Kit (Zymo Research) and was subjected to ChIP-quantitative PCR (qPCR).
9
RIP Assay for RNA-Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RIP assay was conducted according to the previously described protocol (8 (link)). In brief, cells were crosslinked with 0.5% paraformaldehyde for 10 min, and the complexes were fragmented by Bioruptor II ultrasonicator (BM Equipment Co). The crosslinked cell lysates were lysed with RIP buffer supplemented with protease inhibitors and SUPERase-In. The lysates were treated with anti-FLAG antibody (catalog no.: 018-22381; Wako) or normal mouse IgG bound to Dynabeads M-280 sheep antimouse IgG (Invitrogen). The coprecipitated RNAs were extracted with High Pure RNA Tissue Kit and were quantified by QRT–PCR. Percentage enrichment over input was presented.
10
Immunoprecipitation of Amyloid-beta Peptides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aβ peptides were immunoprecipitated using Aβ-specific antibodies coupled to magnetic beads as described previously [38 (link)]. Briefly, 4 μg of the anti-Aβ antibodies 6E10 and 4G8 (Signet Laboratories, Dedham, MA, USA) were separately added to 50 μL each of magnetic Dynabeads M-280 Sheep Anti-Mouse IgG (Invitrogen, Carlsbad, CA, USA). The 6E10 and 4G8 antibody-coated beads were mixed and added to the CSF samples to which 0.025% Tween20 in phosphate-buffered saline (pH 7.4) had been added. After washing, the Aβ peptides were eluted using 100 μL 0.5% formic acid.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!