Mission shrna lentiviral transduction particles

E. coli LPS O55:B5, DAPI, ATP, triton X-100, nigericin, anti-V5 antibody, PMA and puromycin resistant MISSION® shRNA Lentiviral Transduction Particles were from Sigma-Aldrich; Recombinant human caspase-1 and caspase-1 inhibitor Ac-YVAD-AOM were from Merk-Millipore; MSU crystals were from Enzo Life Sciences; flagellin from S. typhimurium from Invivogen; the receptor-binding protein protective antigen and metalloprotease lethal factor were from List Biological; the protein-delivery reagent PULSin was from PolyPlus Transfection;Yo-Pro-1 from Life Technologies. Antibodies for caspase-1 p10, IL-1β, ASC and LAMP1 were from Santa Cruz Biotechnology. Mouse monoclonal anti-NLRP3 was from AdipoGen. Mouse monoclonal anti-Rab5 and anti-EEA1 were from BD Biosciences. All HRP-conjugated secondary antibodies were from GE Healthcare and fluorescent-conjugated secondary antibodies were from Life Technologies.

For DISC1 knock-down in murine primary neurons, we chose a validated shRNA construct developed by Akira Sawa’s group (DISC1 RNAi #1) that has been shown to specifically decrease the amount of DISC1 in cortical neural cell cultures [8 (link),14 (link),37 (link)]. The commercial pLK0.1-puro non-mammalian shRNA control construct from Sigma Aldrich (reference: SHC002) was used as a scramble control. Lentiviruses were produced by calcium phosphate triple co-transfection of shRNA (see Table S3 and Figure S1 in Supporting Information), VSVG and ΔR8.9 constructs into 293FT packaging cells. Virus-containing medium was collected 48 h after transfection, and added (10 mL of lentiviral solution/3 × 10⁶ neurons) to the medium of primary neurons at 7 DIV. The medium was changed 24 h after infection, and incubation continued for 72 h.
In SH-SY5Y cells, DISC1 was silenced using commercial Mission^® shRNA lentiviral transduction particles (Sigma Aldrich, reference NM_018662) containing two alternative PLKO.1-Puro-CMV shRNA plasmids (Table S2 in Supporting Information). Mission^® pLKO.1-puro non-mammalian shRNA particles (reference: SHC002V) were used as control. Stable cell lines were generated for any of these constructs after selection with puromycin as previously described [37 (link)].

As described previously [38 (link)], the knockdown of HDAC6 in U937 cells (lenti-sh-HDAC6) was performed using MISSION® shRNA Lentiviral Transduction Particles (Sigma-Aldrich, St. Louis, MO, USA). The target sequence was 5′- CCGGCCTCACTGATCAGGCCATATTCTCGAGAATATGGCCTGATCAGTGAGGTTTTT-3′. HDAC6-overexpressing U937 cells (lenti-HDAC6) were generated by means of human HDAC6 Lentivirus (pLenti-GIII-UbC, LVP710809, ABM Inc., USA). Lentiviral particles (200 μL in 4 mL of the RPMI 1640 medium supplemented with 10% of FBS) were added to cell culture media and were incubated with the cells for 24 h at 37°C and 5% CO₂. Successfully infected cells (lenti-sh-HDAC6 or lenti-HDAC6) were selected by culturing the transduced cells in the presence of puromycin (3 μg/mL in the medium with 10% of FBS) for 48 h. The cells were then harvested, and the expression of HDAC6 was determined by quantitative PCR (qPCR) and western blotting.

HEK293, HEK293T, HeLa, COS-1, HCT116 and L-Wnt3a cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS). NB4 cells were maintained in RPMI 1640 medium (Gibco, Grand Island, NY, USA) containing 10% FBS. The NB4 cell line was kindly gifted from Dr. Tsai-Yun Chen (National Cheng Kung University, Tainan, Taiwan). All other cell lines were obtained from the American Type Culture Collection (Manassas, VA). All cells were incubated at 37 °C in a 5% CO2 atmosphere. Plasmids were transfected using the PolyJet™ reagent (SignaGen Laboratories, Gaithersburg, MD). For stable SAP130 transfection of HEK293 cells, the plasmid constructs of pCMV3-HA-SAP130 WT or 3KA mutant were transfected into HEK293 cells and selected with hygromycin (100 μg/ml). Human FAF1 shRNA (TRCN0000004244) MISSION® shRNA Lentiviral Transduction Particles were purchased from Sigma-Aldrich (St. Louis, MO). To generate lentivirus-shRNA FAF1 knockdown cells, HEK293T, HCT116 and NB4 cells were infected at low confluence (20%) for 24 h with lentiviral supernatants diluted 1:1 with normal culture medium in the presence of 8 μg/ml of polybrene (Sigma). Forty-eight hours after infection, cells transduced by lentiviruses were selected under 2 μg/ml puromycin for 1 week and then passaged before use.