Pci plasmid

Manufactured by Promega

Sourced in United States

The PCI plasmid is a circular DNA molecule used for the cloning and expression of genetic material in laboratory settings. It contains essential elements for DNA replication and selection in bacterial hosts.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions) Glomax multi microplate luminometer, by Promega (1 mentions) Dual luciferase reporter assay system, by Promega (1 mentions) Fugene, by Promega (1 mentions) One step cloning kit, by Vazyme (1 mentions) Dulbecco s phosphate buffered saline, by Lonza (1 mentions) Pcmv gfp, by Addgene (1 mentions) Aav2 titration elisa kit, by Progen Biotechnik (1 mentions)

Close spelling variants of this product

PCI-neo plasmid

8 protocols using pci plasmid

Antibody Specificity Testing for Olfactory Receptors

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hana3A cells were used for recombinant OR expression to test specificity of the OR antibodies. The Hana3A cells were kindly provided by H. Matsunami (Duke University Medical Center, Durham, NC). The Hana3A cells were maintained under standard conditions as previously described [76 (link)] and grown on cover slips in 24-well plates. Cells were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol with 300 ng of OR plasmid and 60 ng of mRTP1S plasmid (constructed using standard PCR methods).
For the antibody specificity studies, the OR6B2 coding sequence was PCR amplified from human genomic DNA using specific primer pairs (for: 5’-GCATATGAATTCATGAGTGGGGAGAATGTCACC-3’ and rev: 5’-GCATATGCGGCCGCTCAGTGTGAAGTTTGACCCAAGC-3’) that amplify the complete open reading frame and contain the EcoRI and NotI restriction sites for further subcloning into the pCI plasmid (Promega, Madison, USA), which contain the coding sequence for the N-terminal rhodopsin tag (rho-tag, first 20 amino acids of rhodopsin). All plasmid constructs and PCR products were verified by Sanger sequencing.

Flegel C., Schöbel N., Altmüller J., Becker C., Tannapfel A., Hatt H, & Gisselmann G. (2015). RNA-Seq Analysis of Human Trigeminal and Dorsal Root Ganglia with a Focus on Chemoreceptors. PLoS ONE, 10(6), e0128951.

+ Open protocol

+ Expand

Recombinant Plasmid Construction and Minireplicon Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Eukaryotic expression vector pCIwt-NS1 encoding wt-NS1 was constructed by sub-cloning its coding sequence between the XhoI and NotI sites of the pCI plasmid (Promega, Madison, WI, USA). In order to prevent production of spliced mRNAs, splice-donor and splice-acceptor sites were both invalidated by point mutations [33 (link)]. Substitutions within NS1 (R38A-K41A) were introduced using the QuikChange II site-directed mutagenesis kit. Subconfluent HEK293T cells in 24-well plates (one technical triplicate for each condition) were transfected using the FuGENE (Promega, Madison, WI, USA) reagent with the expression vectors of the four viral polymerase subunits (PB1, PB2, PA, and NP) and the pPolI-NS-Renilla encoding the chimeric minigenome (consisting of the NS genome segment with NS1′s Open Reading Frame (ORF) replaced by the Renilla Luciferase ORF), along with the pCI-NS expression vector (or empty vector as a control). The pCMV-Firefly plasmid (Promega) was used as control for transfection efficiency. Twenty-four hours post-transfection, cells were lysed and the activities of the two luciferases were measured using the Dual-luciferase reporter assay system (Promega) and a GloMax-Multi microplate luminometer (Promega). The minireplicon-driven Renilla-luciferase activity was normalized with respect to the activity of the Firefly luciferase, which was used as a transfection control.

Wacquiez A., Coste F., Kut E., Gaudon V., Trapp S., Castaing B, & Marc D. (2020). Structure and Sequence Determinants Governing the Interactions of RNAs with Influenza A Virus Non-Structural Protein NS1. Viruses, 12(9), 947.

+ Open protocol

+ Expand

Modulating MAPK4 and AKT Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

SiHa or caSki cells were transfected with MAPK4 expressing plasmid (MAPK4), shRNA for MAPK4 (sh-MAPK), siRNA for AKT1 and AKT2 (si-AKT1, si-AKT2), plasmid with constitutively activated AKT (CA-AKT) or the corresponding controls (Ctrl or si-NC) using Lipofectamine 2000 (Thermo Fisher Scientific). Three shRNAs for MAPK4, three siRNAs for AKT1 and AKT2 were tested. The siRNA sequences are listed in Table S3. Oligos with highest efficiency were used for subsequent experiments. To construct the MAPK4-overexpressing vector, a One Step Cloning Kit (Vazyme Biotech, Nanjing) was used according to the manufacturer’s instructions. The coding sequence (CDS) of MAPK4 was amplified using a human genomic DNA extracted from SiHa cells and then inserted into the PCI plasmid (Promega, Madison, WI, USA). Primers sequences for cloning MAPK4 CDS into the expressing vector are listed in Table S4. CA-AKT plasmid was purchased from Addgene (catalog no. plasmid #14751, Watertown, MA).

Tian S., Lou L., Tian M., Lu G., Tian J, & Chen X. (2020). MAPK4 deletion enhances radiation effects and triggers synergistic lethality with simultaneous PARP1 inhibition in cervical cancer. Journal of Experimental & Clinical Cancer Research : CR, 39, 143.

+ Open protocol

+ Expand

Production of Recombinant AAV8 Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pAAV-RSV-GFP-pA vector plasmid contains the Rous Sarcoma Virus promoter (RSV), followed by a short synthetic intron (pCI plasmid, Promega, Madison, WI), the enhanced green fluorescent protein (GFP) coding sequence and the late SV40 polyadenylation (pA) signal. The expression cassette was cloned between AAV2 inverted terminal repeats (ITR) (Figure 1). Research grade single-stranded (ss) AAV 2/8 vectors were produced by the INSERM UMR 1089 vector core. Briefly, HEK293 were transfected with the pAAV-RSV-GFP-pA vector plasmid together with helper plasmid pDP8 (which contains AAV2 rep, AAV8 cap, and adenovirus helper genes). Cells were harvested 48–72 hours post-transfection and centrifuged at low speed, then the rAAV8 particles contained in the supernatant were purified by double cesium chloride gradient ultracentrifugation followed by dialysis against Dulbecco’s phosphate-buffered saline (Lonza, Verviers, Belgium). Vector genomes and infectious particles (ip) were quantified by Dot Blot and Replication Center Assay respectively. The vector titers were 1.2 × 10¹³ vg/ml and 2.4 × 10⁹ ip/ml. Detection of Rep-ITR junctions in the final product did not reach the limit of quantification by qPCR.

Dupont J.B., Tournaire B., Georger C., Marolleau B., Jeanson-Leh L., Ledevin M., Lindenbaum P., Lecomte E., Cogné B., Dubreil L., Larcher T., Gjata B., Van Wittenberghe L., Le Guiner C., Penaud-Budloo M., Snyder R.O., Moullier P, & Léger A. (2015). Short-lived recombinant adeno-associated virus transgene expression in dystrophic muscle is associated with oxidative damage to transgene mRNA. Molecular Therapy. Methods & Clinical Development, 2, 15010-.

+ Open protocol

+ Expand

Production and Tagging of Human Dystrophin

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length 427-kd human Dystrophin (huDys) was produced by generating a human Dystrophin cDNA using long-range PCR (primers F1: SpeI_GACTAGTGTGTTCTTCATATGTATATCCTTCC; R1: MluI_CGACGCGTCATTGTGTCCTCTCTCATTG), digested with SpeI and MluI and cloned into pCI plasmid (Promega, Madison, WI, United States) downstream of a CMV promoter at the NheI and MluI restriction sites. Insertion of GFP tag: (1) primers F2 (TCACCTCGAGAAAGTCAAGGCACTTCGAGGAGAAATTG, matching the 3′ huDystrophin cDNA plus a 5′ XhoI site) and R2 (CCTCGCCCTTGCTCACCATGGTTGTGGCCATTGTGTCCTCTCTCATTGGCTTTCCAGGGGTATTTCTTC, designed to remove the Dystrophin stop codon and harbouring first 30 nucleotides of eGFP cDNA) were used on huDys; (2) eGFP cDNA was amplified with F3 (GAAGAAATACCCCTGGAAAGCCAATGAGAGAGGACACAATGGCCACAACCATGGTGAGCAAGGGCGAGG, containing a 5′ free tail encoding the Dystrophin cDNA end) and R3 (GGTACCACGCGTTTACTTGTACAGCTCGTCCATGCC, plus a MluI site); (3) finally, the two products were mixed, amplified with F2 and R3, digested with XhoI and MluI and inserted into pre-digested huDys to generate huDysGFP. GFP was expressed from pCMV-GFP (Addgene 11153). Full-length zebrafish Dystrophin (Lai et al., 2012 (link)) GFP tagged was synthesized by GenBrick and subcloned into pCI-Neo at the MluI-SalI site (GenScript USA Inc., Piscataway Township, NJ, United States). All constructs were fully sequenced.

Bajanca F., Gonzalez-Perez V., Gillespie S.J., Beley C., Garcia L., Theveneau E., Sear R.P, & Hughes S.M. (2015). In vivo dynamics of skeletal muscle Dystrophin in zebrafish embryos revealed by improved FRAP analysis. eLife, 4, e06541.

+ Open protocol

+ Expand

Luciferase-Expressing Neuro-2A Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid pCEP4‐Luc, which was used to generate Neuro‐2A cells stably expressing luciferase, consists of pCEP4 plasmid with the luciferase gene from pGL3 (Invitrogen, Paisley, UK) 1. The pCI‐Luc was created by subcloning the luciferase gene into the pCI plasmid (Promega, Southampton, UK). siRNAs targeting firefly luciferase (siLuc) (GAUAUGGGCUGAAUACAA) 26 and EGFP (siEGFP) (GACGUAAACGGCCACAAGUUC) 27 were synthesized from Dharmacon, Inc (Epsom, UK). The linear lysine peptides used included 8 (K8), 16 (K16), 24 (K24) and 32 (K32) lysines in a row, and they were purchased from ImunnoKontact (Abingdon, UK). Neuro‐2A and Neuro‐2A‐luciferase cells were cultured in DMEM supplemented with 10% foetal calf serum, 1% non‐essential amino acids and sodium pyruvate at 37 °C in humidified atmosphere in 5% carbon dioxide.

Kwok A., McCarthy D., Hart S.L, & Tagalakis A.D. (2016). Systematic Comparisons of Formulations of Linear Oligolysine Peptides with siRNA and Plasmid DNA. Chemical Biology & Drug Design, 87(5), 747-763.

+ Open protocol

+ Expand

Preparation and Purification of AAVLP (HPV16/31L2)

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The AAVLP (HPV16/31L2) were prepared and purified as described in Nieto et al. [26 (link)]:
Briefly the AAV VP2 sequence was cloned into the pCI plasmid (Promega). The VP2 start codon acg was substituted by gag, resulting in translation of only VP3. Nucleotide sequence of L2 residues 17–36 of HPV16 was cloned behind arginine residue 587 and nucleotide sequence of L2 residues 17–36 of HPV31 was cloned behind glycine residue 453. The amino acid sequence of the resulting AAV VP3 protein is shown in Supplementary Fig. S1. Plasmid was transfected via calcium phosphate precipitation into 293T cells. Particles were purified from cell lysate by several chromatographic steps as previously described [25 (link),26 (link)].
The final buffer after purification was 50 mM HEPES, 200 mM NaCl and 2.5 mM MgCl₂. This buffer was also used for dilution to adapt volume and concentration for immunization experiments.
Capsid titer was determined using a commercially available AAV2 titration ELISA kit (Progen, Heidelberg, Germany) according to the manufacturer’s manual.
Determination of Endotoxin content of purified material was performed by BSL Bioservice via turbidimetric kinetic LAL test (BSL Bioservice, Planegg, Germany).

Jagu S., Karanam B., Wang J.W., Zayed H., Weghofer M., Brendle S.A., Balogh K.K., Tossi K.P., Roden R.B, & Christensen N.D. (2015). Durable immunity to oncogenic human papillomaviruses elicited by adjuvanted recombinant Adeno-associated virus-like particle immunogen displaying L2 17–36 epitopes. Vaccine, 33(42), 5553-5563.

+ Open protocol

+ Expand

H3N2 HA Gene Cloning and Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The H3N2 TX98 HA gene coding sequence (GenBank accession no. AEK70342.1) was codon-optimized for optimal expression in swine cells (Sus scrofa). A flag-epitope sequence (DYKDDDDK) was fused in frame to the 3′ end of the gene to facilitate protein detection. The gene fragment was chemically synthesized using a commercial DNA synthesis service (GenScript, Piscataway, NJ, USA) and cloned into the pCI plasmid (Promega, Madison, WI, USA). Large-scale DNA plasmid was amplified in Escherichia coli DH5α and purified by using a plasmid giga prep kit (Zymo Research, Costa Mesa, CA, USA). DNA sequencing was performed to confirm the plasmid sequence’s authenticity.

Nguyen T.N., Kumari S., Sillman S., Chaudhari J., Lai D.C, & Vu H.L. (2023). A Single-Dose Intramuscular Immunization of Pigs with Lipid Nanoparticle DNA Vaccines Based on the Hemagglutinin Antigen Confers Complete Protection against Challenge Infection with the Homologous Influenza Virus Strain. Vaccines, 11(10), 1596.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!