T7 endonuclease

Manufactured by New England Biolabs

Sourced in United States, United Kingdom

T7 endonuclease is a restriction enzyme that cleaves double-stranded DNA at specific recognition sequences. It recognizes and cuts the DNA sequence 5'-TAATAC-3' and its reverse complement 5'-ATTATG-3'.

Automatically generated - may contain errors

Lab products found in correlation

Pcr4blunt topo vector, by Thermo Fisher Scientific (2 mentions) Slhp033rs, by Merck Group (2 mentions) Fetal calf serum (fcs), by Merck Group (2 mentions) Pl crispr efs gfp, by Addgene (2 mentions) Polybrene, by Merck Group (2 mentions) Pmd2 g, by Addgene (2 mentions) Qiaamp dna micro kit, by Qiagen (2 mentions) T7 endonuclease 1, by New England Biolabs (2 mentions) Nebuffer 2, by New England Biolabs (2 mentions) Neb buffer, by New England Biolabs (2 mentions) Phusion high fidelity dna polymerase, by New England Biolabs (2 mentions) Tianamp genomic dna kit, by Tiangen Biotech (2 mentions) Pcw cas9, by Addgene (2 mentions) Plx sgrna vector, by Addgene (2 mentions) T vector, by Takara Bio (1 mentions) Mmessage mmachine t3 kit, by Thermo Fisher Scientific (1 mentions) Megashortscript t7 kit, by Thermo Fisher Scientific (1 mentions) Kod dna polymerase, by Merck Group (1 mentions) Kapa express extract kit, by Roche (1 mentions) Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

T7 endonuclease I assay T7 Endonuclease 1 (T7E1) assay T7 endonuclease I T7 endonuclease I activity assays T7 endonuclease I (T7E1) T7 endonuclease enzyme T7 Endonuclease I (T7EI; T7 endonuclease I enzyme T7 endonuclease assay

46 protocols using t7 endonuclease

Genetic Mutation Analysis in Miscarried and Live Monkeys

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissues including placenta, umbilical cord, ear skin fibroblasts,
peripheral blood were collected and digested in lysis buffer (10 μM
Tris-HCl, 0.4 M NaCl, 2 μM EDTA, 1% SDS and 100
μg/ml Proteinase K). The genomic DNA was extracted from lysate by
phenol-chloroform recovered by alcohol precipitation. Genomic mutations of
miscarried and live monkeys were identified by T7EN1 cleavage assay with T7
Endonuclease (NEB) and Sanger sequencing as described previously (Liu et al., 2014 (link)). Age- and
gender-matched WT controls were housed and fed together with mutants under
the same ambient condition. PCR products with mutations detected by T7EN1
cleavage assay were sub-cloned into T vector (Takara). For each sample,
colonies were picked up randomly and Sanger sequenced by M13-47 primer.

Chen Y., Yu J., Niu Y., Qin D., Liu H., Li G., Hu Y., Wang J., Lu Y., Kang Y., Jiang Y., Wu K., Li S., Wei J., He J., Wang J., Liu X., Luo Y., Si C., Bai R., Zhang K., Liu J., Huang S., Chen Z., Wang S., Chen X., Bao X., Zhang Q., Li F., Geng R., Liang A., Shen D., Jiang T., Hu X., Ma Y., Ji W, & Sun Y.E. (2017). Modeling Rett Syndrome Using TALEN-Edited MECP2 Mutant Cynomolgus Monkeys. Cell, 169(5), 945-955.e10.

+ Open protocol

+ Expand

CRISPR/Cas9-Mediated Zebrafish lpl Gene Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

pT3TS-zCas9 and T7-gRNA plasmids were from Chen lab^{52 (link)} through Addgene. Following the published protocol^{52 (link)}, nls-zCas9-nls mRNA was synthesized with an mMESSAGE mMACHINE T3 kit (ThermoFisher, AM1348) and recovered with lithium chloride precipitation. lpl gRNA was generated using a MEGAshortscript T7 kit (ThermoFisher, AM1354) and purified using a mirVana miRNA isolation kit (ThermoFisher, AM1560). The zebrafish lpl genomic target sequence was 5′-ggctgaaattgattatccttGGG-3′, in which the first 20 nt was the gRNA template and the last 3 nt was protospacer adjacent motif (PAM) required for CRISPR/Cas9 function. 30 pg lpl gRNA and 150 pg nls-zCas9-nls mRNA were injected into 1–2 cells stage embryos. Genomic DNA (gDNA) was extracted from whole embryos or from adult tail tissue using a KAPA Express Extract Kit (KAPA Biosystems, Cat. KR0383). The gDNA fragment containing the target site was amplified using KOD DNA polymerase (EMD Millipore, Cat. 71086) and digested with T7 endonuclease (NEB, Cat. M0302). Primers used for PCR amplification of lpl gDNA fragment were 5′-aacatcagcctcctacacaa-3′ and 5′-tcactcgtttctcatgcgaa-3′.

Liu C., Han T., Stachura D.L., Wang H., Vaisman B.L., Kim J., Klemke R.L., Remaley A.T., Rana T.M., Traver D, & Miller Y.I. (2018). Lipoprotein lipase regulates hematopoietic stem progenitor cell maintenance through DHA supply. Nature Communications, 9, 1310.

+ Open protocol

+ Expand

Circularization and Fragmentation of Illumina Libraries

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pooled Illumina libraries were first circularized by Gibson assembly with a DNA splint containing end sequences complementary to ends of Illumina libraries (Supplemental Table S1). Illumina libraries and DNA splint were mixed at a 1:1 ng ratio using NEBuilder HiFi DNA assembly master mix (NEB E2621). Any noncircularized DNA was digested overnight using ExoI, ExoIII, and Lambda exonuclease (all NEB). The reaction was then cleaned up using SPRI beads at a 0.85:1 (bead:sample) ratio. The circularized library was then used for an overnight RCA reaction using Phi29 (NEB) with random hexamer primers. The RCA product was debranched with T7 endonuclease (NEB) for 2 h at 37°C and then cleaned using a Zymo DNA Clean and Concentrator column-5 (Zymo D4013). The cleaned RCA product was digested using NEBNext dsDNA fragmentase (NEB M0348) following the manufacturer's protocol with a 10-min incubation. For the regular Tn5 library, digested RCA product was cleaned using SPRI beads. For all other libraries, the digested RCA product was size-selected using a 1% low-melt agarose gel: DNA between 2 and 10 kb was excised from the gel, which was then digested using NEB beta-agarase. DNA was then cleaned using SPRI beads.

Zee A., Deng D.Z., Adams M., Schimke K.D., Corbett-Detig R., Russell S.L., Zhang X., Schmitz R.J, & Vollmers C. (2022). Sequencing Illumina libraries at high accuracy on the ONT MinION using R2C2. Genome Research, 32(11-12), 2092-2106.

+ Open protocol

+ Expand

Lentiviral CRISPR-Mediated NKD2 Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

The NKD2-specific guide RNA (forward 5′-CACCGACTCCAGTGCGATGTCTCGG -3′; reverse 5′-AAACCCGAGACATCGCACTGGAGTC -3′) were cloned into pL-CRISPR.EFS.GFP (Addgene #57818) using BsmBI restriction digestion. Lentiviral particles were produced by transient co transfection of HEK293T cells with lentiviral transfer plasmid, packaging plasmid psPAX2 (Addgene #12260) and VSVG packaging plasmid pMD2.G (Addgene #12259) using TransIT-LT (Mirus). Viral supernatants were collected 48-72 hours after transfection, clarified by centrifugation, supplemented with 10% FCS and Polybrene (Sigma-Aldrich, final concentration of 8μg/ml) and 0.45μm filtered (Millipore; SLHP033RS). Cell transduction was performed by incubating the PDGFRß cells with viral supernatants for 48hrs. eGFP expressing cells were single cell sorted into 96-well plates. Expanded colonies were assessed for mutations with mismatch detection assay: gDNA spanning the CRISPR target site was PCR amplified and analyzed by T7EI digest (T7 Endonuclease, NEB M0302S). To determine specific mutation events on both alleles within the clones grown, the PCR product was subcloned into the pCR™ 4Blunt-TOPO vector (Thermo Scientific K287520). Minimum 6 colonies per CRISPR-clone were grown and sent for sanger sequencing (Clone C2: 30 colonies have been sequenced).

Kuppe C., Ibrahim M.M., Kranz J., Zhang X., Ziegler S., Perales-Patón J., Jansen J., Reimer K.C., Smith J.R., Dobie R., Wilson-Kanamari J.R., Halder M., Xu Y., Kabgani N., Kaesler N., Klaus M., Gernhold L., Puelles V.G., Huber T.B., Boor P., Menzel S., Hoogenboezem R.M., Bindels E.M., Steffens J., Floege J., Schneider R.K., Saez-Rodriguez J., Henderson N.C, & Kramann R. (2020). Decoding myofibroblast origins in human kidney fibrosis. Nature, 589(7841), 281-286.

+ Open protocol

+ Expand

CRISPR Editing Detection via PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

To detect CRISPR edits, we amplified a 0.5 to 1 kb genomic region flanking the potential CRISPR editing site by PCR. The PCR product from each candidate plant was mixed with a roughly equivalent amount of wild‐type PCR product of the same locus. The mixture was denatured and annealed in a PCR machine and subsequently digested with 1 µl of T7 endonuclease (New England Biolabs) following the manufacturer's recommendations. We examined the digest on a 1% agarose gel.

Mallett D.R., Chang M., Cheng X, & Bezanilla M. (2019). Efficient and modular CRISPR‐Cas9 vector system for Physcomitrella patens. Plant Direct, 3(9), e00168.

+ Open protocol

+ Expand

Screening for Genomic Deletions via T7 Endonuclease Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA (gDNA) from individual clones (3-8 × 10⁴ cells) was isolated using the QIAamp DNA Micro Kit (Qiagen). To screen for the presence of deletions/ mutations, a T7 endonuclease cleavage assay was used^{28 (link)}. PCR primers were designed to amplify a ~1000 bp region surrounding the area targeted by the sgRNAs (“Long PCR”, Extended Data 5). The PCR amplification was performed using the high fidelity KOD Hot Start DNA polymerase (Novagen). 8.5 μl of each PCR product were denatured and re-annealed, followed by addition of 5 units of T7 endonuclease (New England Biolabs). As an independent confirmation of the presence of deletions, we used primers complementary to the deleted region, therefore incapable of generating any PCR product in deleted clones (“Short-PCR”, Extended Data 5).

Emming S., Bianchi N., Polletti S., Balestrieri C., Leoni C., Montagner S., Chirichella M., Delaleu N., Natoli G, & Monticelli S. (2020). A molecular network regulating the pro-inflammatory phenotype of human memory T lymphocytes. Nature immunology, 21(4), 388-399.

+ Open protocol

+ Expand

CRISPR-Cas9 Gene Editing Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

A PCR was performed on genomic DNA extracted from cells infected with Ksr1 or scrambled sgRNAs. For sgRNA #1, the following primer combination was used (F, TCACGGTGTCATGCTCT and R, TGATACACGGCACCATT). For sgRNAs #2 and #3, the following primer combination was used (F, GCCAGAAAGCAGATGCGA and R, TCACGCTGCCGCATCAG). Each PCR product (200 ng) was incubated for 10 min at 95 °C, slowly cooled down to 30 °C and incubated for 1 h with 10 units T7 endonuclease (New England Biolabs, Ipswich, MA, USA) at 37 °C. Samples were separated on a 10% polyacrylamide gel in TBE buffer. For Ksr1 sgRNA #1, the expected size of the PCR product was 513 bp and cleavage by Cas9 resulted in fragments of 362 and 151 bp. For Ksr1 sgRNA #2, the expected size of the PCR product was 547 bp and cleavage by Cas9 resulted in fragments of 338 and 209 bp. For Ksr1 sgRNA #3, the expected size of the PCR product was also 547 bp and cleavage by Cas9 resulted in fragments of 385 and 162 bp.

Paniagua G., Jacob H.K., Brehey O., García‐Alonso S., Lechuga C.G., Pons T., Musteanu M., Guerra C., Drosten M, & Barbacid M. (2022). KSR induces RAS‐independent MAPK pathway activation and modulates the efficacy of KRAS inhibitors. Molecular Oncology, 16(17), 3066-3081.

+ Open protocol

+ Expand

CRISPR Mutation Detection Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was prepared from CRISPR-treated C2C12 cells using QuickExtract (Lucigen, Madison, WI, USA). The targeted region of CALM1 (400 bp) was PCR amplified using AmpliTaq Gold (ThermoFisher). The PCR amplicons were heated to 95°C and then slowly re-annealed so that mismatches would occur between native (unmutated DNA) and CRISPR-edited DNA. Mismatches were detected using T7 endonuclease (New England Biolabs, Ipswich, MA, USA), which cuts mismatched regions of duplex DNA, including single base mismatches. The extent of T7 cutting was quantified using gel electrophoresis.

Steil A.W., Kailing J.W., Armstrong C.J., Walgenbach D.G, & Klein J.C. (2020). The calmodulin redox sensor controls myogenesis. PLoS ONE, 15(9), e0239047.

+ Open protocol

+ Expand

Quantifying CRISPR-Cas9 Editing Efficiency

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cellular and viral DNA was isolated with the NucleoSpin TriPrep Kit (Macherey-Nagel, Düren, Germany). The UL122/123 target regions were PCR-amplified by targeting either a small sequence (660 bp amplicon, Primers F: GTTCTCGTTGCAATCCTCGGTCAC and R: CGTGGCGGTAGGGTATGTGT) spanning the IE start codon or a larger PCR sequence consisting of the entire UL122/123 region (3862 bp amplicon; Primers F: ACATGAGGGGGAGAAGGACA and R: CGTGGCGGTAGGGTATGTGT). For the T7 assay, the small PCR product was purified with a NucleoSpin column. Two hundred nanograms of purified PCR products was denatured for five minutes at 95 °C and slowly re-annealed using three steps consisting of 15 s at 95 °C, 15 s at 85 °C and 30 s at 25 °C, followed by a 30 min digestion at 37 °C with T7 endonuclease (New England Biolab Inc., UK). The reaction was stopped by the addition of 2 μL 0.25 M EDTA, and the samples were analyzed by capillary electrophoresis on a Caliper LabChip GX device (PerkinElmer). The concentration and purity of each band was measured in comparison to an internal marker, which allowed us to quantify our digested and wild type (WT) bands. The percentage of indels was calculated based on the formula from Hsu et al[25 (link)].

Gergen J., Coulon F., Creneguy A., Elain-Duret N., Gutierrez A., Pinkenburg O., Verhoeyen E., Anegon I., Nguyen T.H., Halary F.A, & Haspot F. (2018). Multiplex CRISPR/Cas9 system impairs HCMV replication by excising an essential viral gene. PLoS ONE, 13(2), e0192602.

+ Open protocol

+ Expand

Genotyping Transgenic Mouse Models

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA from each transgenic mouse and control wildtype mouse were isolated and purified from tails. Two steps
of PCR (nested PCR strategy, two sets of primers around the mutation site) were performed to get a single PCR product (a
single band checked on the gel). 4 primer sequences are: Chrdl1-p-5a: GTTCTCTGGAAGACAGGAAGTAC; Chrdl1-p-5b:
CAACCTGGGTTTCAGTATCATC; Chrdl1-p3a: GCTGTGGTTTCCATTCAAGG and Chrdl1-p-3b: CTATCCTCTATGCCCTGTGC. Primers Chrdl1-p-5a and
Chrdl1-p-3a will generate 1166 bp PCR product, and primers Chrdl1-p-5b and Chrdl1-p-3b will produce 644 bp PCR product.
644 bp PCR products were cleaned up by DNA Clean and Concentrator-25 kit (Zymo Research 11–305) then 1 ug of 644 bp
PCR products from each pup were denatured, annealed, and treated with T7 endonuclease (NEB M0302). Digested PCR products
were separated on an ethidium bromide-stained agarose gel (2%). For DNA sequencing, PCR products were cloned using the
CloneJet PCR Cloning Kit (Thermo Scientific K1231), and mutations were identified by sequencing to identify the actual
mutations (deletion or point mutations).

Blanco-Suarez E., Liu T.F., Kopelevich A, & Allen N.J. (2018). Astrocyte-secreted chordin like 1 drives synapse maturation and limits plasticity by increasing synaptic GluA2 AMPA receptors. Neuron, 100(5), 1116-1132.e13.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!