Plko 1 plasmid

The full length NDRG1 cDNA was synthesized by RT-PCR from normal colon epithelial cells (NCM460). Then the cDNA was sub-cloned into the pcDNA3.1 plasmid (Invitrogen, Carlsbad, CA, USA). The shRNA sequences were synthesized and then cloned into pLKO.1 plasmid (Sigma Aldrich, St. Louis, MO, USA). The NDRG1/shNDRG1 plasmids and corresponding empty vector were transfected into CRC cells (HCT116 and RKO) using Lipofectamine 2000 reagent (Invitrogen) following the manufacturer’s protocol. Stable clones were selected by puromycin (1 μg/ml). All these stable transfects were tested regularly by western analysis to ensure the efficiency of over-expression or knockdown.

Construction of myc-His-GCase plasmids was described elsewhere [36 (link)]. pSC2-6myc ARTS was described in [34 (link)]. MISSION shRNA plasmid (TRCN0000000285) encoding parkin-targeted shRNA was purchased from Sigma-Aldrich (St Louis, Mo, USA).
To construct the PARIS-expressing vector, a 1.9 kb PARIS cDNA fragment was amplified using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, USA) from the plasmid cFUGW-lenti-PARIS, a kind gift from Dr. Ted M. Dawson (Solomon H. Snyder Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA). The PARIS cDNA fragment was cloned into the Ecl136II site of pEGFPC3 vector plasmid (Clontech Laboratories Inc. CA, USA). Gibson assembly technology (New England Biolabs, Ipswich, USA) was used for the cloning. For knockdown of parkin, MISSION short hairpin RNA (shRNA) plasmids, encoding small interfering RNAs (siRNAs) targeting parkin, were purchased from Sigma Aldrich (St Louis, Mo, USA). Of all the existing vectors, TRCN0000000285 successfully knocked down human parkin. As a control, a pLKO.1 plasmid (Sigma Aldrich, St Louis, Mo, USA) harboring shRNA against GFP was used.

C-terminal Flag-tagged KIAA1522 were cloned into pLVX-IRES-ZsGreen plasmid. The forward shRNA sequences for targeting human KIAA1522 are as follow: sh-1: CCGGCCACGGCCTTCGATACTTATGCTCGAGCATAAGTATCGAAGGCCGTGGTTTTTG; sh-2: CCGGCCTACCTGTCGAAGTTGATTCCTCGAGGAATCAACTTCGACAGGTAGGTTTTTG. shRNA sequences were cloned into pLKO.1 plasmid (Sigma-Aldrich, Missouri, USA). The sgRNAs for targeting mouse kiaa1522 gene are as follow: sg-1: GCCGAGAGTGACAACCGTCA; sg-2: AGTGGGAGACCTCCTCATCT. The sgRNA sequences were cloned into lentiCRISPRv2 plasmid which was a gift from Feng Zhang (Addgene plasmid # 52961) [27 (link)] The lentiCRISPR-EGFP sgRNA1 plasmid (Addgene plasmid #51760) from Feng Zhang was used as sgRNA control [28 (link)]. HEK293t cells were used for lentivirus packaging. Lentiviral vectors expressing target genes were co-transfected with lentiviral packaging plasmids psPAX2 (Addgene plasmid, 12,260) and pMD2.G (Addgene plasmid, 12,259) with Lipofectamine® 3000 (Invitrogen). The medium containing lentivirus was harvested at 48 h and 72 h after transfection and used to infect cultured cell lines. Transduced cells were isolated by puromycin selection or FASC sorting.

Plasmid and siRNA transfection were performed with Lipofectamine3000 (Thermo) following the manufacturer’s instruction. Specific custom siRNAs were synthesized in GenePharma (Shanghai, China). For stable knockdown, shRNAs were cloned into pLKO.1 plasmid (Sigma). To obtain viral particles, 10 µg of lentiviral construct, 10 µg of pSPAX2, and 5 µg of pMD2G were co-transfected into HEK293T cells using Lipofectamine3000 (Thermo). About 48 h after transfection, the supernatants were collected and filtered through 0.22 µm membrane (Millipore). Virally infected cells were selected with appropriate concentration of puromycin (Sigma) to obtain stable cell lines. The sequences of siRNA or shRNA used in this study were listed in Supplementary Table 2.

The reagents used in this study were as follows: liposomes were purchased from Invitrogen (Carlsbad, CA, USA); glycine, lauryl sodium sulfate, tetramethylethylenediamine, TRIzol, and tris(hydroxymethyl)aminomethane were purchased from Amresco (Solon, OH, USA); acrylic amide was purchased from Merck (Darmstadt, Germany); bovine serum albumin (BSA) was purchased from Roche (Basel, Switzerland); fluorescent protein solutions were purchased from Pierce (Rockford, IL, USA); ammonium peroxydisulfate, dimethyl sulfoxide (DMSO), N, N’-methylenebisacrylamide, and puromycin were purchased from Sigma (St. Louis, MO, USA); trypsin, Dulbecco’s modified Eagle’s medium (DMEM) with high glucose, and fetal bovine serum were purchased from HyClone (Logan, UT, USA); PrimeSTAR DNA polymerase and T4 DNA ligase were purchased from TaKaRa (Tokyo, Japan); GAPDH, P62, CHK1, CHK2, MYTl, WEEl, CDC25, CDC25C, ATM, CDK1, LC3, p68-CHK1, p216-CDC25C, p15-CDK1, p1981-ATM, SQSTM1/P62, pCHK2, pCHK1, CDC, pCDC25C, and MPM2 antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), Cell Signaling Technology (Danvers, MA, USA), or Millipore/Upstate(NY, USA); and the pLKO.1 plasmid was purchased from Sigma (Darmstadt, Germany).