The total RNA for all samples was isolated using the RNeasy Plant Mini Kit (Qiagen) and any contaminating genomic DNA was degraded with TURBO DNase kit (Ambion) according to the manufacturer's instructions. RNA was diluted to 10 ng/μL and first-strand cDNA and qPCR were performed using Luna Universal One-Step RT-qPCR master mix (New England Biolabs) in a 20-µL reaction. qPCR analysis was performed on a 7500 Real Time PCR System (Applied Biosystems) using the UBQ10 (At4G05320) gene from A. thaliana as an internal reference (29 (link)). qPCR was performed in a 96-well optical PCR plate (ABgene) using the following parameters: 1 cycle of 10 min at 95 °C,and 40 cycles of 15 s at 95 °C, 15 s at 58 °C and 15 s at 65 °C, and 1 cycle of dissociation from 58 to 95 °C with 1 ° temperature increments. The qPCR primers used in this study are presented in SI Appendix, Table S1 .
Luna universal one step rt qpcr master mix
Manufactured by New England Biolabs
Sourced in United States
The Luna Universal One-Step RT-qPCR master mix is a reagent used for reverse transcription and quantitative PCR (RT-qPCR) analysis. It enables the detection and quantification of RNA targets in a single reaction.
Automatically generated - may contain errors
Lab products found in correlation
Turbo dnase kit, by Thermo Fisher Scientific (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Mic qpcr cycler, by Bio Molecular Systems (1 mentions)
Rnaqueous micro rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Lightcycler 96 real time pcr system, by Roche (1 mentions)
Quantstudio 3 real time pcr machine, by Thermo Fisher Scientific (1 mentions)
Rnaprotect, by Qiagen (1 mentions)
4 protocols using luna universal one step rt qpcr master mix
1
RT-qPCR Analysis of Plant Transcripts
2
Quantifying α-catenin mRNA in Nematostella
3
Quantifying Gene Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess changes in gene expression in NSs-treated cells, qPCR analysis was carried out. RNA was isolated using the Maxwell RSC purification kit (Promega; WI, USA), and 10 ng of total RNA was reverse transcribed and amplified using Luna® Universal One-Step RT-qPCR master mix (NEB; MA, USA) in the LightCycler96 real-time PCR system (Roche; Basel, Switzerland). Cycling conditions were as follows: reverse transcription (55 °C for 10 min) and initial denaturation (95 °C for 1 min) followed by 40 cycles of denaturation (95 °C for 10 s) and extension (60 °C for 30 s, with plate read). The fold change in gene expression was determined using the 2-ΔΔCt method. The following qPCR primers were purchased from IDT (Integrated DNA Technology; IA, USA): B2M Fwd: 5’ TAGAGGTGGGGAGCAGAGAA, B2M Rev: 5’ TCCCCCAAATTCTAAGCAGA, GFP Fwd: 5’GACAACCACTACCTGAGCAC, GFP Rev: 5’CAGGACCATGTGATCGCG.
4
Quantitative Expression Analysis of Key Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were grown for 48 hours after lipofection before being harvested using RNAprotect (Qiagen). Total RNA was extracted using Direct-zol RNA microprep kit and quantified. Each condition was performed in triplicate using 50 ng of total RNA. For each 20 ul reaction, RNA was added to Luna Universal One-Step RT-qPCR master mix (New England Bio Labs) and two RT-qPCR primers at a final concentration of 0.4 μM. The following amplification cycle was run on a QuantStudio 3 realtime PCR machine (ThermoFisher Scientific): 55 °C for 10 min, 95 °C for 1 min, followed by 95 °C for 10 sec and 60 °C for 1 min for 40 cycles. All genes were normalized to beta Actin (ACTB) and expression was determined via relative quantification to lipofectamine only carrier control. Gene specific primers for each gene of interest were ordered from Integrated DNA Technologies and are as follows: ACTB: 5'-CACCATTGGCAATGAGCGGTTC-3' and 5'-AGGTCTTTGCGGATGTCCACGT-3', TBK1: 5'-GGATCACTGCCATTTAGACCC-3' and 5'-CAGGCATGTCTCCACTCCAG-3' (PrimerBank 309747068c3), KRT14: 5'-TGAGCCGCATTCTGAACGAG-3' and 5'-GATGACTGCGATCCAGAGGA-3' (PrimerBank 83641893c1), HNRNPA1: 5'-TCAGAGTCTCCTAAAGAGCCC-3' and 5-ACCTTGTGTGGCCTTGCAT-3' (PrimerBank 83641893c1).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!