Mouse anti mvh

Testes were fixed in Bouin’s overnight, embedded in paraffin, and sectioned at 4 μm. Following standard protocols, sections were deparaffinized, rehydrated, and then stained with Hematoxylin and Eosin for histology. Immunostaining of testis cryosections was prepared as previously described (Kim et al., 2012 (link)). The primary antibodies used in this study were as follows: rabbit anti-H3K27me2 (1:6000; Cell Signaling), rabbit anti-H3K27me3 (1:1000; Cell Signaling), mouse anti-MVH (1:1000, Abcam), mouse anti-γH2AX (1:1000; Millipore and Cell Signaling), mouse anti-PLZF (1:500, Calbiochem), and rabbit anti-cleaved Caspase-3 (1:200, Cell Signaling). Secondary antibodies conjugated with either Alexa Fluor 488 or 594 (Molecular Probes) were used at a dilution of 1:500. In situ hybridization was performed as described previously (Chandler et al., 2007 (link)) with antisense probes to Ezh1. The probe was generated by PCR sub-cloning a mouse Ezh1 cDNA fragment into pGEM T-Easy using the following gene specific primers: (F) CTGATCAGCGATGCTGTGTT; (R) GCCCACAACCTGTGTTTTCT.