Dox was purchased from Dalian Meilun Biology Technology Co. Ltd (Dalian, China). Targeting human VEGF siRNA (sense: 5′-ACAUCACCAUGCAGAUUAUdTdT-3′, anti-sense: 5′-dTdTUGUAGUGGUACGUCUAAUA-3′) was obtained from Guangzhou Ribobio Co., Ltd (Guangzhou, China). CGA oligodeoxynucleotides (sequence: 5′-CGACGACGACGACGACGACGA-3′; complementary sequence: 5′-TCGTCGTCGTCGTCGTCGTCG-3′) were purchased from BGI Co. (Shenzhen, China). Fetal bovine serum (FBS) was obtained from Sijiqing Co., Ltd, (Zhejiang, China) and 3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide (MTT) was from Sigma-Aldrich (St Louis, MO, USA). Trizol RNA extraction was from Thermo Fisher Scientific (Waltham, MA, USA). SYBR®Green and ReverTra Ace qPCR RT Kit were purchased from Toyobo (Osaka, Japan). All solutions were made up in Millipore ultrapure water (EMD Millipore, Billerica, MA, USA) and sterilized for cell culture. All other chemicals and reagents were of analytical grade and used as received. All the primers used in real-time PCR were synthesized and purified by BGI Co. with sequences: VEGF – forward: 5′-CTGGAGTGTGTGCCCACTGA-3′; VEGF – reverse: 5′-TCCTATGTGCTGGCCTTGGT-3′; actin – forward: GAGCTACGAGCTGCCTGACG; actin – reverse: CCTAGAAGCATTTGCGGTGG.
Trizol rna extraction
Manufactured by Thermo Fisher Scientific
Sourced in United States
TRIzol® is a ready-to-use reagent for the isolation of total RNA from a variety of biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components that facilitates the lysis of cells and the dissolution of cell components.
Automatically generated - may contain errors
Lab products found in correlation
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Directional mrna sequencing sample preparation protocol, by Illumina (2 mentions)
Duplex specific thermostable nuclease normalization protocol, by Illumina (2 mentions)
Sybr green realtime master mix, by Toyobo (2 mentions)
Revertra ace rt pcr kit, by Toyobo (2 mentions)
3 4 5 dimethyl 2 thiazolyl 2 5 diphenyl 2h tetrazolium bromide mtt, by Merck Group (1 mentions)
Revertra ace qpcr rt kit, by Toyobo (1 mentions)
Sybr green, by Toyobo (1 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (1 mentions)
Hiseq 4000, by Illumina (1 mentions)
Nebnext ultra rna library prep kit, by Illumina (1 mentions)
Nextera xt kit, by Illumina (1 mentions)
Nextseq 500, by Illumina (1 mentions)
Glycogen, by Thermo Fisher Scientific (1 mentions)
Cfx real time qpcr instrument, by Bio-Rad (1 mentions)
Pro200, by PRO Scientific (1 mentions)
Abi 7500, by Thermo Fisher Scientific (1 mentions)
Abi high capacity cdna rt kit, by Thermo Fisher Scientific (1 mentions)
Qubit 3 fluorometer, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
18 protocols using trizol rna extraction
1
VEGF Silencing via siRNA Transfection
2
RNA-Seq of Mouse Organ Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mouse kidney, liver, lung, and spleen using TRIzol RNA extraction (Thermo Fisher Scientific). After phase separation, RNA was purified using the PureLink RNA Mini Kit (Thermo Fisher Scientific). Purified total RNA sample was treated with DNase I (TURBO DNA-freeTM kit, Ambion Inc.) to remove traces of DNA. RNA libraries were prepared using the NEBNext Ultra RNA library prep kit (Illumina) according to the manufacturer’s instructions. In brief, total RNA starting with 1 μg was poly-A selected, fragmented by random priming and then converted to cDNA using ProtoScript II reverse transcriptase. The cDNA was then end-repaired, adenylated and ligated with Illumina sequencing adaptors. Libraries from all samples were pooled and sequenced using an Illumina HiSeq 4000 with 50-bp pair-end read.
3
RNA-seq Library Construction from Sorted Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell populations were sorted directly into Trizol with 0.5% 2-ME and held at −80 °C until RNA preparation. RNA was prepared by published Trizol RNA-extraction protocol (Thermo-Fisher Scientific). RNA was co-precipitated using glycogen as a carrier. RNA was quantified using Qubit RNA high sensitivity fluorometric assay. cDNA was prepared using Takara Clonetech SMART-Seq® v4 Ultra® Low Input RNA Kit according to protocol using 500–1000 ng RNA as input. cDNA was quantified and qualified using HSDNA assay on an Agilent 2200 bioanalyzer. RNA-seq libraries were constructed using the Illumina Nextera XT kit with 150 ng cDNA input. Libraries were quality controlled and quantified by bioanalyzer and pooled at equal molar ratio preceding sequencing Illumina Hiseq (50 bp SE v4 high output) and Illumina Nextseq500 (75 bp SE v2) machines.
4
Genotyping and Gene Expression Analysis of Zebrafish Larvae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Larvae from heterozygous in-crosses (dmisti8/+ or dmistvir/+) were genotyped by tail biopsy at 3 dpf (Wilkinson et al., 2013 (link)) and allowed to recover fully in individual wells of a square welled 96-well plate before euthanising at 5 dpf. RNA was extracted from three 5 dpf embryos of each genotype by snap freezing in liquid nitrogen and TRIzol RNA extraction (Ambion 15596026) with the following modifications to the manufacturer’s protocol: 400 μl total TRIzol reagent used to homogenise larvae using a pellet pestle homogeniser, and 5 μg glycogen (Invitrogen, Cat# 10814010; 20 μg/μl) was added to the RNA solution after chloroform extraction to aid precipitation of the RNA. The cDNA library was synthesised from high-quality RNA (Agilent AffinityScript qPCR cDNA synthesis kit 600559), diluted 1:10, and gene-specific primers (Table 2 ) were used for amplification of target genes with SYBR green mastermix in a Bio-Rad CFX Real-Time qPCR instrument. Gene expression levels were normalised to the housekeeping gene ef1alpha (primers in Table 2 ) and analysed using custom MATLAB scripts (MATLAB v9.2 2017, The MathWorks 2017).
5
RNA Extraction and qPCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For experiments utilizing myometrial tissue, frozen samples were mechanically homogenized (PRO200, Proscientific, CT, USA) and total RNA samples were isolated using TRIzol RNA extraction as per manufacturer's protocol (Ambion, TX, USA). For mRNA isolation from cultured cells, Total RNA was isolated from HM6ERMS2 and hTERT-HM cells by using the RNeasy/QIAshredder Mini Kit (Qiagen, Germantown, MD) according to the manufacturer's instructions. RNA quality and quantity were determined using Qubit 3 Fluorometer (Life Technologies, MA, USA). 1 µg of total RNA samples were then reverse-transcribed to cDNA using ABI high-capacity cDNA-RT kit (Life Technologies, MA, USA) as per manufacturer's protocol. cDNA was diluted and 10 ng/well was analyzed by qPCR (ABI7500; Life Technologies, MA, USA) using SYBR Green Master Mix as per the manufacturer's instruction (Life Technologies, MA, USA). Human GAPDH was used as an internal control for gene expression normalization. Fold changes in gene expression were calculated using the 2−ΔΔCT method. Primers used in this study were designed using PrimerQuest (IDT) and procured from IDT (Newark, USA). Primer efficiencies were ≥85% with hHM cDNA and specificity was validated using melt curve and electrophoresis analysis of the amplified product. Sequences of all primer sets used in the study are detailed in Supplementary Table S2 (34 (link)).
6
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from RAW cells according to a standard Trizol RNA extraction protocol supplied by Invitrogen (Invitrogen, Life Technologies). Extracted RNA was treated with DNase (Qiagen) to ensure that no DNA was present in the samples. DNA-free RNA (500 ng) was mixed with 50 ng of random hexamers and 50 μM of oligo (dT) (Invitrogen) at a final volume of 10 μl, then reverse transcribed to cDNA with Superscript III reverse transcriptase (Invitrogen) following the manufacturer's recommendations.
7
Arbovirus Detection in Mosquito Pools
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Heads and thoraxes of mosquitoes (n = 665 out of 672) from Pucak were tested for arboviruses. Individual specimens were pooled in groups of up to 30 based on genus to maximize efficiency: Aedes, Anopheles, Armigeres and Culex. A standard TRIzol RNA extraction as described by the manufacturer (Invitrogen) was used to isolate viral RNA. Extracted RNA was stored at − 20 °C until further testing. After RNA extraction, a reverse-transcriptase PCR was performed following the protocol for SuperScript III one-step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) for all specimens using previously described primers: Flavivirus F (5′-TAC AAC ATG ATG GGA AAG AGA GAG AA-3′) and Flavivirus R (5′-GTG TCC CAG CCG GCG GTG TCA TCA GC-3′); Alphavirus F (5′-(CT)AG AGC (AGT)TT TTC GCA (CT)(GC)T (AG)GC (ACT) (AT)-3′) and Alphavirus R (5′-ACA T(AG)A AN(GT) GNG TNG T(AG)T C(AG)A ANC C(AGT)A (CT)CC-3′); and Bunyavirus F (5’-CTG CTA ACA CCA GCA GTA CTT TTG AC-3′) and Bunyavirus R (5′-TGG AGG GTA AGA CCA TCG TCA GGA ACT G-3′) [54 (link)–57 (link)].
8
RNA-sequencing for Functional Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 2
RNA-sequencing on WM35, WM3248, M14, and SK-MEL-28 cells was performed to determine functional methylation, i.e., methylation associated with downregulated gene expression [26]. In brief, total ribonucleic acid (RNA) was isolated using the standard procedure for TRIzol® RNA extraction (Invitrogen, Bleiswijk, The Netherlands) and stored at −80° C. For total RNA sequencing, library preparation was carried out using a modified version of the Illumina “Directional mRNA-sequencing Sample Preparation” protocol with total RNA instead of mRNA. Ribosomal DNA was depleted from the DNA fraction using Illumina's Duplex-Specific Thermostable Nuclease normalization protocol for bidirectional mRNA sequencing (application note 15014673).
9
Quantifying Esophageal Gene Expression
10
RNA-seq for Functional Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 2
RNA-sequencing on WM35, WM3248, M14, and SK-MEL-28 cells was performed to determine functional methylation, i.e., methylation associated with downregulated gene expression [26]. In brief, total ribonucleic acid (RNA) was isolated using the standard procedure for TRIzol® RNA extraction (Invitrogen, Bleiswijk, The Netherlands) and stored at −80° C. For total RNA sequencing, library preparation was carried out using a modified version of the Illumina “Directional mRNA-sequencing Sample Preparation” protocol with total RNA instead of mRNA. Ribosomal DNA was depleted from the DNA fraction using Illumina's Duplex-Specific Thermostable Nuclease normalization protocol for bidirectional mRNA sequencing (application note 15014673).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!