For a precise evaluation of PCR sensitivity, we constructed a plasmid containing an insert of the target sequence amplified from the Ppa F149 strain. For this purpose, the product of PCR amplification was purified using ISOLATE II PCR and Gel Kit (Bioline, St. Petersburg, Russia) and cloned to pAL2-T vector using a QuickTA kit (Evrogen). Plasmid DNA used as standard was purified with a QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Sanger sequencing of the corresponding region in the resulting plasmid confirmed the correctness of the insert.
Quick ta kit
Manufactured by Evrogen
The Quick-TA kit is a laboratory tool designed for DNA cloning and plasmid preparation. It provides a rapid and efficient method for extracting and purifying plasmid DNA from bacterial cultures.
Automatically generated - may contain errors
Lab products found in correlation
Isolate 2 pcr and gel kit, by Meridian Bioscience (2 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
Mint cdna synthesis kit, by Evrogen (1 mentions)
Mint race cdna amplification set, by Evrogen (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Px458 plasmid, by Addgene (1 mentions)
Facsmelody, by BD (1 mentions)
Transit lt1 transfection reagent, by Mirus Bio (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
5 protocols using quick ta kit
1
Plasmid Construction for PCR Sensitivity
2
Cloning and Sequencing of P. atrosepticum DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extracted DNA of P. atrosepticum strain SCRI1043 was used for further PCR amplification of the target sequence with designed primers. The reaction conditions were as in paragraph 2.5. The resulting PCR product was purified using ISOLATE II PCR and Gel Kit (Bioline, St. Petersburg, Russia) and cloned to pAL2-T vector (Quick-TA kit, Evrogen, Russia, Moscow). Escherichia coli Nova Blue strain (Novagen, Houston, TX, USA) was used for the propagation of the test plasmid. The insert was verified by Sanger sequencing using standard flanking primers (Evrogen).
3
Total RNA Extraction and RACE Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from blood cells of S. rustica using TRI Reagent (Sigma) and reverse-transcribed with MINT cDNA synthesis kit (Evrogen) according to the manufacturer’s instructions. MINT RACE cDNA Amplification Set (Evrogen) was used for 3′ and 5’ RACE. For 3’RACE, nested degenerate oligonucleotide primers were designed using the iCODEHOP algorithm [64 (link)] on the basis of the determined amino acid sequence (Table 3 ; #1, 2). Primers for 5′RACE (Table 3 ; #3, 4) were based on the DNA sequence obtained in 3’RACE. Both 3′ and 5’PCR products were cloned in pAL2-T vector, using Quick-TA kit (Evrogen, Russia), and Sanger sequenced in Evrogen.
Oligonucleotide primers used in the study
| Primer | Sequence 5′-3′ | |
|---|---|---|
| 1 | Sr_P26_3’_F1 | ggnaa |
| 2 | Sr_P26_3’_F2 | |
| 3 | Sr_P26_5’_R1 | cattgtgccaagttc |
| 4 | Sr_P26_5’_R2 |
h = a,c,t; y = c,t; s = c,g; n = a,g,c,t; m = a,c; w = a,t. Bold letters with underscore – overlaying parts of nested primers
4
Generating B2M Knockout iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Guide RNA (gRNA) GAGTAGCGCGAGCACAGCTA targeting exon 1 of B2M gene was designed with CRISPOR [43 (link)] and cloned into a PX458 plasmid (Addgene #48138). iPSCs were transfected with TransIT®-LT1 Transfection Reagent (MirusBio) according to the manufacturer’s protocol. On day 2 after transfection, GFP-positive iPSCs were sorted by FACSMelody (BD Biosciences) and 2 × 104 cells were seeded into Matrigel-coated 35 mm culture dishes in Essential 8™ + 10 μM Y27632 medium. On day 12 after transfection, single cell clones of potential B2M KO iPSCs were picked up manually and transferred to a 48-well plate for clonal expansion. On day 17 after transfection, we selected HLA-I negative iPSCs clones, and the lack of B2M and HLA-I expression was confirmed by flow cytometry. On-target genome editing of B2M gene was verified by Sanger sequencing. The fragments spanning the targeted region generated in PCR amplification were cloned into pAL2-T vector using Quick-TA kit (Evrogen). Recombinant plasmids from individual bacterial clones were then sequenced with M13 standard primers. Characterization of iPSCs was performed as described previously [44 (link)] with modest modifications (see Additional file 1 ).
5
Cloning and Sequencing of DNA Fragments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Freshly prepared PCR products were ligated with a vector using the Quick-TA kit (Evrogen, Russia), which included the pAL2-T vector, Quick-TA T4 DNA Ligase, buffer, M13 forward primer, and M13 reverse primer, according to the manufacturer’s instructions. Chemical transformation of competent Escherichia coli (Migula 1895) Castellani and Chalmers 1919 DH10B cells was then performed. Transformed colonies carrying inserts of the expected size were selected on selective LB medium (DIA-M, Moscow, Russia) with 100 µg/mL of ampicillin (BioChemica, PanReac Applichem, Spain). The purified amplified fragments were sequenced in both directions using M13 primers and the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems™, Waltham, MA, USA) on a 3500 Applied Biosystems Genetic Analyzer. For DNA methylation analysis, at least 10 clones were sequenced for each amplicon. The alignment of sequences was carried out using SnapGene 6.1.2 (https://www.snapgene.com/ (accessed on 10 December 2022)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!