U2OS and HEK-293 cells were grown as adherent cells in Dulbecco’s modified eagle medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin/streptomycin and 2 mM GlutaMax. Specific lentiviruses used were pGipz vectors (Dharmacon) targeting MCM2 or MCM3. The shRNAs MCM2 (V3LHS_315340) and MCM3 (V3LHS_409660) were expressed using the mature antisense sequences AGTTGTTGTGATAGATGCC and TTCTTGACCTGCCATGACGT, respectively. The pGIPZ non-silencing lentiviral shRNA was used as control vector (RHS4346). The pGipz vectors were modified to replace the GFP by mCherry using Gibson assembly to avoid interference with the GFP-based assays. Viruses were produced in HEK293T cells grown in OptiMEM and transfected with the corresponding pGIPZ plasmid, along with pLP1, pLP2 and pLP-VSVG (ViraPower™ Lentiviral Expression Systems (Life Technologies)) using Lipofectamine 2000 (Life Technologies). After 3 hours, the culture medium was changed and cells were incubated for 2 days. The supernatant was harvested and filtered using 0.45 μm syringe filters. For infection of U2OS and HEK-293 cells, 4 μg/mL of polybrene were added to 1.5 mL of virus-containing supernatant and added to the cell culture medium. At two days post-infection, the culture medium was changed and selection was carried out by the addition of puromycin at a final concentration of 5 µg/ml.
Pgipz vector
Manufactured by Horizon Discovery
Sourced in United States
The PGIPZ vector is a plasmid-based genetic engineering tool used for the introduction and expression of target genes in various cell types. It contains the necessary genetic elements for cloning, expression, and selection of recombinant constructs.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Pqc membrane tdtomato 9 construct, by Addgene (2 mentions)
Plvx ires hyg vector, by Takara Bio (2 mentions)
Plko 1 blast shrna plasmid, by Addgene (2 mentions)
Pgl3 basic luciferase vector, by Promega (1 mentions)
Lenticripsr v2, by Addgene (1 mentions)
Ab92516, by Abcam (1 mentions)
Dharmafect 1 transfection reagent, by Horizon Discovery (1 mentions)
Retro x concentrator, by Takara Bio (1 mentions)
Sidesign, by Horizon Discovery (1 mentions)
Pgipz lentiviral vector, by Horizon Discovery (1 mentions)
Psuper retro puro retroviral vector, by Oligoengine (1 mentions)
11 protocols using pgipz vector
1
Lentiviral Knockdown of MCM2/MCM3 in U2OS and HEK-293 Cells
2
Molecular Cloning and Knockdown Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR-amplified human Hpd (NM_001171993.1), Ttc36 (NM_001080441.2), Peli1 (NM_020651.4), Stk33 (NM_001289058.1), Rnf138 (NM_001191324.1) and ubiquitin (NM_001281716.1) were subcloned into CMV, pTriEX, or pcDNA3.1 vector. pcDNA3.1-His/V5-Hpd contained nonsense mutations of T2A, T3A, T23A, T138A,
T219A, T271A, T337A, T382A. CMV-Flag-HPD contained truncation of HPD (1–280aa), ΔC (1–165aa), ΔN (166–393aa), ΔN1 (166–280aa), ΔN2 (281–393aa), and VOC2 (180–338), and ΔTPR (deletion of TPR-binding site). CMV-Flag-Peli1 contained nonsense mutation of R104A. pcDNA3.1-Stk33 contained dead mutation of K145M. All plasmids were listed in Supplementary Table1 .
For Ttc36, Peli1, and Stk33 knockdown, the shRNA pGIPZ vectors were purchased from GE Dharmacon (Lafayette, CO, USA), the target sequences were described in Supplementary Table2 .
T219A, T271A, T337A, T382A. CMV-Flag-HPD contained truncation of HPD (1–280aa), ΔC (1–165aa), ΔN (166–393aa), ΔN1 (166–280aa), ΔN2 (281–393aa), and VOC2 (180–338), and ΔTPR (deletion of TPR-binding site). CMV-Flag-Peli1 contained nonsense mutation of R104A. pcDNA3.1-Stk33 contained dead mutation of K145M. All plasmids were listed in Supplementary Table
For Ttc36, Peli1, and Stk33 knockdown, the shRNA pGIPZ vectors were purchased from GE Dharmacon (Lafayette, CO, USA), the target sequences were described in Supplementary Table
3
Genetic Manipulation via Plasmid Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase chain reaction (PCR)-amplified human ASL, GABPA, KDM5C, and TERT were cloned into pcDNA3.1/hygro(+)-Flag, pcDNA3-HA, or pGEX-4T-1 vector. The TERT promoter region was PCR amplified and inserted into pGL3-Basic luciferase vector (Promega, Madison, WI, USA). ASL S417A, ASL Q286R, ASL S365A, TERT -124C>T, or TERT -146C>T mutants were generated using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA). pGIPZ vectors carrying shRNAs targeting ASL (5'-CCCATCATGGAGAAGTTCA-3') were purchased from Dharmacon (Lafayette, CO, USA). To generate shRNA-resistant (r) ASL WT, ASL S417A, and ASL Q286R constructs, the non-sense mutations (5'-CCaATaATGGAaAAaTTCA-3') were made into ASL shRNA-targeting sites using the QuikChange site-directed mutagenesis kit. The primers used for luciferase reporter cloning are listed in Table S2.
4
Generating Lentiviral and Retroviral Constructs for Cell Line Engineering
5
Molecular Cloning and Genetic Manipulation Protocols
6
CRISPR/shRNA-mediated L1CAM, CDH1, and REST modulation
7
Lentiviral Knockdown of Orai3 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For stable knockdown generation, human specific shOrai3 and shNT were cloned in the lentiviral pGIPZ vector (Dharmacon, Lafayette, CO, USA) were used. As reported earlier, the lentiviral constructs pCMV-VSVG, pCMV- dR8.2 and pGIPZ-shNT/shOrai3 were co-transfected in a flask containing 95% confluent HEK293FT cells [34 (link)]. Lipofectamine 2000 (Thermo Fisher, Waltham, MA, USA) was used as a transfection reagent to transfect HEK293FT cells. Viral particles containing medium were collected at 48 and 72 h after transfection and was concentrated using Amicon filters through centrifugation. These concentrated viral particles were used to transduce cells seeded at 50% confluency and knockdown was confirmed by performing Western blot analysis.
8
Systematic shRNA Library for Splicing Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In total, 613 shRNAs targeting 230 known or putative splicing factor genes (full list is provided in Supplementary Data 1 ) in the pGIPZ vector (Dharmacon) were subcloned into pMLS (MSCV-LTRmir30-SV40-GFP)48 (link) with XhoI and EcoRI.
9
Generating Lentiviral and Retroviral Constructs for Cell Line Engineering
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Generation of pLenti-CMV-YFP and retroviral pBMN-mCherry were previously described11 (link). pCDH-CMV-MCS-EF1a-eGFP-T2A-Puro (System Bioscience #CD510B-1) was a kind gift from Dr. Weilin Jin (Shanghai Jiao Tong University, China). To generate the pLVX-tdTomato-IRES-Hygro construct, tdTomato cDNA was isolated from the pQC-membrane tdTomato IX construct (Addgene #37351) by polymerase chain reaction (PCR) and subcloned into the pLVX-IRES-Hyg vector (Clontech #632185). pLenti-VIIb-EVP-Neo-mVenus-p27K- was generously provided by the Paddison laboratory (FHCRC). This vector encodes a mutant form of p27 that lacks cyclin-dependent kinase inhibitory activity, and an mVenus reporter for quiescence72 . pBABE-YAP1-S127A, S127AS397A and S94A mutant constructs73 were kind gifts from the Vasioukhin lab (FHCRC). YAP mutant cDNA regions were amplified and subcloned into the pCDH-CMV-MCS-EF1a-eGFP-T2A-Puro construct with a FLAG tag at the 5’ end. Stable knockdown of human DAG1 was achieved with shRNAs cloned with a mir30 background in the pGIPZ vector (Dharmacon). To target human ITGA6, ITGB1, YAP1 or murine DAG1, the pLKO.1-blast shRNA plasmid (Addgene#26655) was used. All shRNA sequences are detailed in Supplementary Table 3 .
10
CRT Depletion in MDA-MB-231 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRT was depleted in MDA MB 231 cells by lentiviral shRNA. Knockdown clones of CRT were generated using the pGIPZ vector (Dharmacon) packaged in HEK293T cells following standard protocols. Briefly, HEK293T cells were transfected using 4 μg GIPZ lentiviral CRT shRNA with Lipofectamine 2000. The virus-containing media was harvested 24 and 48 h after transfection for transduction in MDA MB 231 cells. Clones were selected by adding 2 μg/ml puromycin and subsequently maintaining 0.25 μg/ml puromycin media. For all knockdown clones created, a GIPz vector control clone (containing a scrambled nonspecific sequence in place of a shRNA) was generated simultaneously. CRT depletion was verified by Western blot analysis (anti-CRT, Abcam, Ab92516). Transient knockdown of CRT in CT26 cells was achieved by applying SMART Pool On Target siRNA sequences (Dharmacon) with Dharmafect 1 transfection reagent (Dharmacon) to cells as per the manufacturer’s protocol. The siRNA sequences are listed in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!