The total RNA of the lungs or cells was isolated with triazole reagent (Thermo Fisher Scientific) based on the manufacturer's protocol. The cDNA was generated from the RNA samples using the Prime foot RTMasterMix (TAKARA Bio Inc., Shiga, Japan). Real-time PCR was carried out by the SYBR green PCR master mixture (Thermo Fisher Scientific) on a Thermal Cycle instrument (Jena Analysis, Germany). The specific primer sequences were shown in Table S2
Triazole reagent
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Triazole reagent is a laboratory chemical compound used in various analytical and synthetic procedures. It serves as a versatile building block in organic chemistry and biochemistry applications. The core function of the Triazole reagent is to facilitate specific chemical transformations and reactions.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green pcr master mixture, by Thermo Fisher Scientific (3 mentions)
Dextran sulfate sodium (dss), by Yeasen (2 mentions)
Hiscript 2 q rt mix, by Vazyme (2 mentions)
Prism 9, by GraphPad (2 mentions)
Nuclease free water, by AppliChem (1 mentions)
Nuclease free glycogen, by Thermo Fisher Scientific (1 mentions)
Isopropanol, by Merck Group (1 mentions)
Chloroform, by Merck Group (1 mentions)
A kit, by Takara Bio (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Vazyme (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Abi 7300, by Thermo Fisher Scientific (1 mentions)
Abi prism 7300 sds software, by Thermo Fisher Scientific (1 mentions)
Sybr green qrt pcr, by Thermo Fisher Scientific (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rt qpcr primers, by RiboBio (1 mentions)
Primescript rt pcr kit, by Takara Bio (1 mentions)
13 protocols using triazole reagent
1
Quantitative Analysis of Lung RNA
2
RNA Extraction from Serum Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Serum samples were incubated on ice for a complete thaw process. Immediately, triazole reagent (1:1 ratio) (Thermo Fisher Scientific, MA, USA) and nuclease-free glycogen (1 μg/mL) (Thermo Fisher Scientific, MA, USA) were added, respectively. They were then incubated at room temperature for 10 min. Afterward, 200 μL of chloroform (Merck Millipore, Darmstadt, Germany) was added and the samples were incubated for 15 min. Next, they were centrifuged at 12,000 × g for 15 min at 4 °C. Upper aqueous phase was transferred, and 1.2 mL of isopropanol (Merck Millipore, Darmstadt, Germany) was added to the samples. After that, the samples were vortexed and then incubated for 10 min at room temperature. They were centrifuged at 12,000 × g for 8 min. The supernatants were aspirated carefully. One milliliter of 75% ethanol was added and the samples werecentrifuged at 7500 × g for 5 min at room temperature. The supernatant was carefully removed, and the tubes were dried out at room temperature. Each pellet was resuspended with 20 μL of nuclease-free water (AppliChem, Gatersleben, Germany) and stored at –80 °C for further evaluation.
3
Quantitative PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Triazole reagent (Thermo Fisher Scientific) was used to extract RNA from mpkCCDc14 cells. A Kit (Takara, Japan) was used for reverse transcription of RNA. PCR was performed using SYBR Green Master Mix (Applied Biosystems, USA) and the Applied Biosystems Step One Plus Real-Time PCR system. The following sequences of primers were used: α-ENaC forward 5′-TGTGTCCAGCTACAAACCAATG-3′ and reverse 5′-CATCATGCCCACTTCGTAACA-3′; Cofilin forward 5′-CAGACAAGGACTGCCGCTAT-3′ and reverse 5′-TTGCTCTTGAGGGGTGCATT- 3′; GAPDH forward 5′-GCAAGTGCTTCT AGGCGGAC-3′ and reverse 5′-AAGAAAGGGTGTAAAACGCAGC-3′.
4
mRNA Extraction and Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells or frozen liver were lysed in 1 ml triazole reagent (Invitrogen). The total mRNA was extracted and reverse transcribed into complementary DNA (cDNA) using the Reverse Transcription Kits (Vazyme, R223-01). The real-time PCR was performed. Amplification reactions were set up in 10 μl volumes containing primers, cDNA, and SYBR Green. All qPCR primer sequences in this study are listed in Table S1 .
5
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were made using the Triazole reagent (Invitrogen). Reverse transcription and cDNA synthesis used the Quantitect Reverse transcription kit following the manufacturer’s instructions (Qiagen). Primers are listed in Supplementary Table 4 . The PCR reaction was performed using Quantifast SYBR green PCR master kits (Qiagen).
6
Quantifying Nrf2 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using triazole reagent (Invitrogen, USA) according to the manufacturer's instructions. One-step qRT-PCR was done with TaKaRa One-Step SYBR® PrimeScriptTM PLUS RT-PCR Kit on StepOne real-time PCR machine by ΔΔCt method. Oligonucleotide primers for Nrf2 (forward, 5′- AAGAATAAAGTCGCCGCCCA -3′; reverse, 5′-AGATACAAGGTGCTGAGCCG-3′) were synthesized by Sangon Biotech (Shanghai, China). Reaction parameters were as follows: step 1, 42 °C for 5 minutes; step 2, 95 °C for 10 seconds; step 3, 95 °C for 10 seconds; step 4, 50 °C for 30 seconds; and step 5, 72 °C for 30 seconds. Step 3 to step 5 was repeated for 35 cycles. The level of Nrf2 mRNA was analyzed by StepOne Software version 2.1. The relative amount of Nrf2 was normalized to the amount of endogenous β-actin.
7
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular nucleic acid was separated by triazole reagent (Invitrogen, USA), dissolved in H2O, and stored at −80°C without nucleic acid. cDNA was then synthesized according to the manufacturer’s plan using SYBR Green qRT-PCR (Thermo Fisher Scientific) kit. Subsequently, reverse transcription polymerase chain reaction based on cDNA was carried out on real-time detectors (ABI, ABI-7300, USA). Quantitative and real-time chain reaction of polymerase was carried out on an ABI 7900 high temperature testing instrument (ABI city, New York, USA).
The real-time PCR was as follows: 1) 95°C for 10 minutes; 2) 95°C for 15 seconds; 3) 60°C for 45 seconds; 4) Repeat steps 2–3 40 times; 5) 95°C for 15 seconds; (6) Heat insulation at 60°C for 1 minute; 7) 95°C for 15 seconds; 8) 60°C for 15 seconds, and 9) 4°C forever. The experiments were carried out in triplicate for each data point.
The sequences of the primer pairs were:
RT-Primer (5ʹ GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATCA 3ʹ),
PCR Primer:
forward (5ʹ CGTCCCCCAGGTGTGATTC 3ʹ),
reverse (5ʹAGTGCAGGGTCCGAGGTATT 3ʹ).
The results were analyzed by the reference loop method using the software included with the instrument (ABI Prism 7300 SDS Software).
The real-time PCR was as follows: 1) 95°C for 10 minutes; 2) 95°C for 15 seconds; 3) 60°C for 45 seconds; 4) Repeat steps 2–3 40 times; 5) 95°C for 15 seconds; (6) Heat insulation at 60°C for 1 minute; 7) 95°C for 15 seconds; 8) 60°C for 15 seconds, and 9) 4°C forever. The experiments were carried out in triplicate for each data point.
The sequences of the primer pairs were:
RT-Primer (5ʹ GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATCA 3ʹ),
PCR Primer:
forward (5ʹ CGTCCCCCAGGTGTGATTC 3ʹ),
reverse (5ʹAGTGCAGGGTCCGAGGTATT 3ʹ).
The results were analyzed by the reference loop method using the software included with the instrument (ABI Prism 7300 SDS Software).
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used Triazole reagent (Invitrogen) to extract total RNA from cells or human tissues, according to the manufacturer’s instructions. The concentration of RNA was measured using a NanoDrop ultra-violet spectrometer (Thermo Fisher Scientific). The cDNA was reverse‑transcribed from the mRNA using the Prime Script RT reagent kit (TaKaRa, Tokyo, Japan). Real-time PCR was performed using Fast SYBR Green Master Mix (Applied Biosystems, Rockford, IL USA) with 3 sub-well replicates. Thermocycling conditions were chosen according to the manufacturer’s protocol. All results were normalized to GAPDH mRNA. The primers for GAPDH and BRF2 were: GAPDH, forward GCACCGTCAAGGCTGAGAAC and reverse TGGTGAAGACGCCAGTGGA; BRF2 forward as mentioned above. Relative gene expression was then analyzed using the ΔΔCq method. Each experiment was performed at least three times.
9
Analyzing orb2 and miRNAs in B. dorsalis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs from B. dorsalis testis and other body tissues were isolated using Triazole reagent (Invitrogen, Waltham, MA, USA). For orb2, cDNA was synthesized using the Prime Script RT-PCR Kit (TaKaRa, Japan) and quantitative real time (RT- PCR) PCR was performed using the SYBR Premix Ex Taq (TaKara). B-Actin was used as an internal control for normalization. Primers for qRT-PCR are given in Table S1 for miR-125-3p, miR-276b-3p, and U6 snRNA, cDNA was synthesized using Stem loop PCR primers. SYBR Green Master Mix (miScript SYBR Green PCR Kit, Qiagen, Hilden, Germany) was used to perform real-time PCR. All quantitative real-time PCR was done on an Applied Biosystems, Carlsbad, CA, USA. The stem loop primers, RT-qPCR primers for miRNA-125-3p, miR-276b-3p, and U6 snRNA were prepared from Ribobio (Guangzhou, China). The 2−△△Ct method was used to normalize the expression of orb2 and miRNAs.
10
Extraction and Characterization of Sea Conch Bioactive Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sea conchs were obtained from the seafood market (in Lvshunkou, Liaoning, and Dalian, China). Trypsin was bought from RHAWN Chemicals in China. Dextran sodium sulfate was purchased from Yeasen Biotechnology in Shanghai, China. Antibodies were bought from Proteintech (Wuhan, China). Different ELISA kits for IL1-β, IL-17, IL-10, TNF-α (Shanghai Jianglai Industrial Share Ltd., Shanghai, China). triazole reagents (Thermo Fisher Scientific Waltham, MA, USA ); all other reagents used in experiments were of analytical grade.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!