The Pierce™ Agarose ChIP Kit (cat no. 26156, Thermo Scientific, USA) was used to conduct the ChIP assays in accordance with manufacturer's protocol, the HUVEC cells were fixed with 4% paraformaldehyde and incubated with glycine for 10 min to generate DNA–protein cross-links. Then, the cells were lysed with Cell Lysis Buffer and Nuclear Lysis Buffer and sonicated to generate chromatin fragments. Next, the lysates were immunoprecipitated with Magnetic Protein A Beads conjugated with Smad2-specific antibodies (Abcam), or IgG as a control. Finally, the precipitated DNA was analyzed by qRT-PCR. The primers specific for Id4 promoter were used as following: Smad2, sense, 5’- TCCGAAGGGAGTGACTAGGA -3’, anti-sense, 5’- CCGAGCCCAACAATTGAC -3’; And the primers for GAPDH were as sense, TACTAGCGGTTTTACGGGCG, anti-sense, TCGAACAGGAGGAGCAGAGAGC GA.
Magnetic protein a beads
Manufactured by Abcam
Magnetic Protein A Beads are a protein A-coated magnetic bead product designed for the efficient capture and purification of antibodies from complex biological samples. The beads are superparamagnetic and can be easily separated from the sample using a magnetic rack or separator.
Automatically generated - may contain errors
2 protocols using magnetic protein a beads
1
ChIP Assay for Smad2 Binding
2
ChIP Assay for NOTCH3 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assay was performed using a High‐Sensitivity ChIP Kit (Abcam) according to the manufacturer's specifications. In brief, cells were fixed with 4% paraformaldehyde and incubated with glycine for 20 min to enhance DNA‐protein cross‐links. Then cells were lysed, and DNA was sonicated to generate chromatin fragments of 400‐800 bp. After sonication, the DNA fragments were immunoprecipitated with Magnetic Protein A Beads conjugated with YBX1 antibody (Abcam) or rabbit nonimmune IgG (as negative control) overnight. The next day, the precipitated DNA was analyzed by PCR with NOTCH3 promoter‐specific primers.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!