Rabbit primers

Total RNA was extracted from cells using TRIzol (Invitrogen, U.S.A.). Then, 10 μl of the extracted RNA was reverse-transcribed using RevertAid™ First-Strand cDNA Synthesis Kit (Sangon Biotech, China). The reaction parameters were as follows: 65°C for 5 min, 42°C for 30 min, and 70°C for 10 min. One microliter of the resulting cDNA was used for qPCR using the following cycle parameters: 40 cycles at 95°C for 3 min, 95°C for 3 min, and 60°C for 30 s. The housekeeping gene β-actin was used as internal reference. Using the comparative threshold method, the relative expression quantity of the target gene = 2^−ΔΔC_t was used to determine the initial amount of template of the sample. The sequences of the rabbit primers (Sangon Biotech, China) were as follows: NMNAT3-F: 5′-CCCGTCAATGACAGCTACAGGAAG-3′; NMNAT3-R: 5′-AGCACCTTCACCGTCTCCATCC-3′; β-actin-F: 5′-TCCCTGGAGAAGAGCTACGA-3′; β-actin-R: 5′-GTACAGGT CCTTGCGGATGT-3′.

We extracted RNA from BMSCs via column affinity purification (QIAGEN, Hilden, Germany) and synthesized complementary DNAs (cDNAs) using M-MuLV RT Master Mix with Oligo(dT) (Sangon Biotech, Shanghai, China). We performed RT-PCR on a StepOnePlus system (Applied Biosystems, California, USA) in 96-well plates with specific primers and SYBR Green Mix (Sangon Biotech). Rabbit primers (Sangon Biotech) were as follows: Parkin-F: TGACCAGTTGCGTGTGATCTTCG; Parkin-R: GTTGTCTCCTCCAGGCGTGTTG; P53-F: ATGGAGGAG TCGCAGTCGGATC; P53-R: GGTGGTCAGCAGGTTGTTCTCAG; ACTB-F: TCCCTGGAGAAGAGCTACGA; ACTB-R: GTACAGGT CCTTGCGGATGT. We calculated the fold change value of mRNA expression over that of control using the ^ΔΔCt method.