The largest database of trusted experimental protocols

Specific reverse transcription kit

Manufactured by Vazyme
Sourced in China

The Specific reverse transcription kit is a laboratory tool designed to convert RNA into complementary DNA (cDNA) in a targeted and efficient manner. It facilitates the reverse transcription process, a crucial step in various molecular biology applications.

Automatically generated - may contain errors

3 protocols using specific reverse transcription kit

1

Circular RNA Expression Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA isolation was performed using Trizol reagent (Solarbio, Beijing, China). Then, the complementary DNA (cDNA) was synthesized using the specific reverse transcription kit (Vazyme, Nanjing, China). Subsequently, the RNA level was examined via AceQ qPCR SYBR Green Master Mix (Vazyme) and quantified via the 2−ΔΔCt method. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) acted as the internal reference to normalize the expression of circ_0005615 and NOTCH1, and U6 was used as the endogenous control to normalize the expression of miR-665. All primers were shown: circ_0005615-F: 5′-TCACCCTTTACCTGGAGCAAA-3′, circ_0005615-R: 5′-GAGCTGAAACGATGGTGACAAA-3′; miR-665-F: 5′-ACCAGGAGGCTGAGGC-3′, miR-665-R: 5′-GAACATGTCTGCGTATCTC-3′; NOTCH1-F: 5′-GAGGCGTGGCAGACTATGC-3′, NOTCH1-R: 5′-CTTGTACTCCGTCAGCGTGA-3′; GAPDH-F: 5′-GAAGGTGAAGGTCGGAGT-3′, GAPDH-R: 5′-GATGGCAACAATATCCACTT-3′; and U6-F: 5′-CTCGCTTCGGCAGCACA-3′, U6-R: 5′-ACGCTTCACGAATTTGCGT-3′.
+ Open protocol
+ Expand
2

Quantitative Real-Time PCR Analysis of circRNA, miRNA, and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
After isolating RNA using Trizol reagent (Solarbio, Beijing, China), the specific reverse transcription kit (Vazyme, Nanjing, China) was utilized to obtain complementary DNA. Then, the RNA levels were monitored via SYBR Green PCR Master Mix (Vazyme) and quantified using the 2−ΔΔCt method. Glyceraldehyde 3-phosphate dehydrogenase (GADPH) or U6 was taken as an internal control. The primer sequences were shown in Table 2.

Quantitative Real-Time PCR Primer

Primer NameSequence
circ_0109046-FTTCAACGGCATGGAAGGGTT
circ_0109046-RGCATCTGAAGGTTTGAGGCAG
miR-136-FACACTCCAGCTGGGACTCCATTTGTTTT
miR-136-RCCAGTGCAGGGTCCGAGGT
HMGA2-FACCCAGGGGAAGACCCAAA
HMGA2-RCCTCTTGGCCGTTTTTCTCCA
GAPDH-FGGTCTCCTCTGACTTCAACA
GAPDH-RGTGAGGGTCTCTCTCTTCCT
U6-FCTCGCTTCGGCAGCACA
U6-RAACGCTTCACGAATTTGCGT
+ Open protocol
+ Expand
3

Circular RNA Expression Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
TRIzol reagent (Leagene, Beijing, China) was applied for extracting total RNA. Afterwards, cDNA was synthesized using the specific reverse transcription kit (Vazyme, Nanjing, China). For detecting RNA levels, qRT-PCR reactions were carried out using SYBR Green Master Mix (Vazyme). RNA levels were quantified via the 2−ΔΔCt method. GAPDH (for circ_0003204 and HDAC9) and U6 (for miR-942-5p) were regarded endogenous controls. The primers included: circ_0003204-F: 5′-C A T G G G G C T G T G T C A C C T G-3′, circ_0003204-R: 5′-G G C A A C T G G T G T G G A A G A G A-3′; miR-942-5p-F: 5′-C T T C T C T G T T T T G G C C A T G T G-3′, miR-942-5p-R: 5′-C T C T A C A G C T A T A T T G C C A G C C A C-3′; HDAC9-F: 5′-A G T A G A G A G G C A T C G C A G A G A-3′, HDAC9-R: 5′-G G A G T G T C T T T C G T T G C T G A T-3′; GAPDH-F: 5′-G C T G A G T A C G T C G T G G A G T C-3′, GAPDH-R: 5′-A G T T G G T G G T G C A G G A G G C-3′; U6-F: 5′-C T C G C T T C G G C A G C A C A-3′, U6-R: 5′-A A C G C T T C A C G A A T T T G C G T-3′.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!