Cloned using Invitrogen’s Multisite Gateway cloning. EGFP/mApple were amplified by PCR with a 5′ attB1 and 3′ attB2 recombination site. To the 5′ attB1 primer the 51 bp Lifeact sequence (atgggtgtcgcagatttgatcaagaaattcgaaagcatctcaaaggaagaa) was added to incorporate Lifeact directly upstream of either the mApple or EGFP sequence. PCR product was gel purified and recombined with a pDONR221 plasmid (Invitrogen) to create the L1L2 entry vector. This was then recombined with pLenti6.3-DEST (Invitrogen) to create the expression plasmid.
Plenti6.3 dest
Manufactured by Thermo Fisher Scientific
The PLenti6.3-DEST is a lentiviral expression vector designed for high-level, constitutive expression of genes of interest in a wide range of cell types. The vector contains the constitutive human CMV promoter for robust gene expression, as well as recombination sites for Gateway cloning to facilitate the rapid insertion of your gene of interest.
Automatically generated - may contain errors
3 protocols using plenti6.3 dest
1
Lifeact-Labeled Fluorescent Protein Cloning
2
SPOCK1 Lentiviral Transduction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SPOCK1 Gateway donor complementary (c)DNA was purchased from DNasu Plasmid Repository and then recombined into the plenti6.3-DEST (Invitrogen) vector by Clonase LR (Invitrogen). The Plenti-6.3-SPOCK1, pMD.G, and pCMVDR8.91 plasmids were transfected into 293 T cells for packing the lentivirus. Target cells were incubated with viral supernatants for 48 h.
3
Engineered EGFR Mutant Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The EGFR-L747P, del19, L858R, del19/T790M, or L858R/T790M mutant was created by Quikchange mutagenesis using pENTR-EGFR, and lentiviral plasmid pLenti6.3-EGFR-L747P or other mutants were cloned by LR clonase II using pENTR-EGFR (L747P or other mutants) and pLenti6.3-DEST (Invitrogen). Lentivirus was prepared by transfecting pLenti6.3-EGFR-L747P or other mutants with a helper plasmid (ViraPower) in 293FT cells. Ba/F3 cells were infected using lentivirus-containing medium supplemented with polybrene (8 µg/mL), and after an incubation of 24 h, the infected cells were selected using 7 µM blasticidin (Invitrogen) for one week. After the selection, cells were cultured in a culture medium without IL-3.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!