Fastprep system

Manufactured by Qbiogene

Sourced in France

The FastPrep system is a high-performance tissue homogenizer designed for the efficient disruption and homogenization of various sample types, including plant, animal, and microbial samples. It utilizes rapid, high-speed shaking to effectively break down samples and release their contents for downstream processing and analysis.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (4 mentions) Rneasy mini kit, by Qiagen (3 mentions) Microbexpress kit, by Thermo Fisher Scientific (1 mentions) Dnase treatment, by Thermo Fisher Scientific (1 mentions) Rnalater, by Thermo Fisher Scientific (1 mentions) Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions) Turbo dnase, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Positively charged nylon membrane, by GE Healthcare (1 mentions) Ready to go dna labeling beads, by GE Healthcare (1 mentions) 32p dctp, by PerkinElmer (1 mentions)

3 protocols using fastprep system

RNA Extraction for RNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction for RNA seq was performed essentially as previously described^{11 (link)}. Briefly, 3 mL cell samples were mixed with RNAlater (Ambion®, Naerum, Denmark). Total RNA was extracted from two independently grown samples using a FastPrep system (Qbiogene, Illkirch, France) and an RNeasy Mini kit (Qiagen, Sollentuna, Sweden), and quantity and quality of RNA was determined using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Hvidovre, Denmark). After DNase treatment (Thermo Scientific, Hvidovre, Denmark), rRNAs (23S and 16S) were removed by subtractive hybridization using the MICROBExpress kit (Ambion®, Naerum, Denmark). Removal of rRNAs was confirmed with an Agilent 2100 Bioanalyzer (Agilent Technologies, Glostrup, Denmark).

Møller T.S., Liu G., Hartman H.B., Rau M.H., Mortensen S., Thamsborg K., Johansen A.E., Sommer M.O., Guardabassi L., Poolman M.G, & Olsen J.E. (2020). Global responses to oxytetracycline treatment in tetracycline-resistant Escherichia coli. Scientific Reports, 10, 8438.

+ Open protocol

+ Expand

Gene Expression Quantification by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bacteria were grown to logarithmic phase in LB (OD_600nm = 0.4±0.01). RNA was isolated from 1.5 ml aliquots of overnight cultures by mechanical disruption with the FastPrep system (Bio101; Q-biogene) and by using the RNeasy mini kit (Qiagen). Quantity and quality of total RNA was determined with the NanoDrop 1000 spectrophotometer (Thermo Scientific). The RNA was DNase treated with the TURBO™ DNase and reverse transcribed with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following the supplier's recommendations. The qPCR was done with the Maxima SYBR Green/Rox qPCR Master Mix and gene specific oligonucleotides (Table ) in a MxPro3000 cycler. The gene rsmC[37] was used as reference.

Herrero-Fresno A., Wallrodt I., Leekitcharoenphon P., Olsen J.E., Aarestrup F.M, & Hendriksen R.S. (2014). The Role of the st313-td Gene in Virulence of Salmonella Typhimurium ST313. PLoS ONE, 9(1), e84566.

+ Open protocol

+ Expand

Transcriptional Response to Colistin in S. aureus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exponential-phase cultures were adjusted to an OD₆₀₀ of 0.25 in warm MH broth, and 150 µg/ml colistin was added. At different time points, cells were harvested by centrifugation at 8,000 rpm for 3 min. The cells were lysed mechanically using the FastPrep system (Bio101; Qbiogene), and total RNA was extracted using a Qiagen RNeasy minikit according to the manufacturer’s instructions. RNA quantity and quality were measured on a NanoDrop ND-1000 spectrophotometer based on the absorbance (the A₂₆₀ and the A₂₆₀/A₂₈₀ and A₂₆₀/A₂₃₀ ratios, respectively). Four micrograms of RNA from each preparation was loaded onto a 1% agarose gel and transferred to a positively charged nylon membrane (GE Healthcare). The hybridization was performed using gene-specific probes labeled with [³²P]dCTP (PerkinElmer) and Ready-to-Go DNA-labeling beads from GE Healthcare. Internal fragments of the genes were amplified using the following primers: graR-forward, TGCTGGTATTGAAGATTTCG; graR-reverse, CCTACTTTTGTTTCGATTGC; vraR-forward, GTGGATGATCATGAAATGGT; vraR-reverse, TGGAATGCATAGATAACAGC; mprF-forward, CTGTGGTGTAATTGTTGACG; mprF-reverse, TAATTACCGCCGTACTGATT; dltB-forward, ACCAACAGGCAATGAATATC; dltB-reverse, TAAGTGCTGTTGTGAAACCA. The PCR products were used as the templates in the labeling reactions.

Haaber J., Friberg C., McCreary M., Lin R., Cohen S.N, & Ingmer H. (2015). Reversible Antibiotic Tolerance Induced in Staphylococcus aureus by Concurrent Drug Exposure. mBio, 6(1), e02268-14.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!