Full length primers to amplify the mouse Ccl22 encoding gene were 5’ATGGCTACCCTGCGTGTCCCACTC3’ and 5’ CTAGGACAGTTTATGGAGTAGCTTCTTCACCCAG3’. The PCR product was isolated from gel after amplification of cDNA, prepared using RNA extracted from cultured B16 melanoma cells CRL-6475 (ATCC, Manassas, VA). Resulting DNA was ligated into the TA expression vector CT-GFP TOPO (Invitrogen, Grand Island, NY) and sequenced using a T7 primer (Invitrogen). This DNA and empty vector control DNA was used to coat 1μm gold particles (Alfa Aesar, Ward Hill, MA) in presence of spermidine (Sigma Aldrich, St. Louis, MO). Expression vector-gold complexes were used to coat Teflon bullets (BioRad, Hercules, CA), containing 1 μg of expression plasmid DNA each. Bullets were stored under vacuum desiccation and used within 14 days.
Ct gfp topo
Manufactured by Thermo Fisher Scientific
The CT-GFP TOPO is a cloning vector product offered by Thermo Fisher Scientific. It is designed for the rapid and efficient cloning of PCR products into a plasmid. The vector contains a gene encoding green fluorescent protein (GFP) that can be used as a reporter for successful cloning.
Automatically generated - may contain errors
2 protocols using ct gfp topo
1
Mouse Ccl22 Gene Amplification and Expression
2
Mouse Ccl22 Gene Amplification and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full length primers to amplify the mouse Ccl22 encoding gene were 5’ATGGCTACCCTGCGTGTCCCACTC3’ and 5’ CTAGGACAGTTTATGGAGTAGCTTCTTCACCCAG3’. The PCR product was isolated from gel after amplification of cDNA, prepared using RNA extracted from cultured B16 melanoma cells CRL-6475 (ATCC, Manassas, VA). Resulting DNA was ligated into the TA expression vector CT-GFP TOPO (Invitrogen, Grand Island, NY) and sequenced using a T7 primer (Invitrogen). This DNA and empty vector control DNA was used to coat 1μm gold particles (Alfa Aesar, Ward Hill, MA) in presence of spermidine (Sigma Aldrich, St. Louis, MO). Expression vector-gold complexes were used to coat Teflon bullets (BioRad, Hercules, CA), containing 1 μg of expression plasmid DNA each. Bullets were stored under vacuum desiccation and used within 14 days.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!