To construct KAT7 3′UTR luciferase reporter plasmids, included top, 5′-CTAGCCCTGTCATTCCGAGCCAGCGAACT-3′, and bottom, 5′-CTAGAGTTCGTGGCTCGGAATGACAGGG-3′. The strands of KAT7 3′UTR were annealed and inserted into the NheI and XbaI restriction sites of the pmirGLO dual-luciferase miRNA target vector (Promega), generating vector pmirGLO/Luc-KAT7 3′UTR. In addition, the mutant top (5′-CTAGCCCTGTCATTCCGAGCACGATGACT-3′) and mutant bottom (5′-CTAGAGTCATCGTGCTCGGAATGACAGGG-3′) strands of KAT7 3′UTR were annealed and inserted into the NheI and XbaI restriction sites of pmirGLO dual-luciferase miRNA target vector (Promega, Madison, WI, USA), and generated the vector pmirGLO/Luc-KAT7 3′UTR mut. Construction of the plasmid pcDNA3-KAT7 for KAT7 overexpression, and the whole sequences of KAT7 were obtained from the KAT7 cDNA using the PCR primers:
The whole sequences of KAT7 were inserted into the HindIII and XbaI restriction sites of pcDNA3.1. To construct the KAT7 knockdown plasmid, shRNA sequences of shRNA-KAT7 sense (5′-GATCCGCTCAAATACTGGAAGGGAAACTCGAGTTT CCCTTCCAGTATTTGAGCTTTTTGA-3′) and antisense (5′-AGCTTCAA AAAGCTCAAATACTGGAAGGGAAACTCGAGTTTCCCTTC CAGTATTTGAGCG-3′) oligonucleotides were annealed and inserted into the BamHI and HindIII of pSilencer 2.1-U6 Neo vector (Thermo Fisher Scientific, Waltham, MA, USA), generated by pshR-KAT7 plasmids.
The whole sequences of KAT7 were inserted into the HindIII and XbaI restriction sites of pcDNA3.1. To construct the KAT7 knockdown plasmid, shRNA sequences of shRNA-KAT7 sense (5′-GATCCGCTCAAATACTGGAAGGGAAACTCGAGTTT CCCTTCCAGTATTTGAGCTTTTTGA-3′) and antisense (5′-AGCTTCAA AAAGCTCAAATACTGGAAGGGAAACTCGAGTTTCCCTTC CAGTATTTGAGCG-3′) oligonucleotides were annealed and inserted into the BamHI and HindIII of pSilencer 2.1-U6 Neo vector (Thermo Fisher Scientific, Waltham, MA, USA), generated by pshR-KAT7 plasmids.