Kapa probe fast mastermix

Total RNA was extracted from abdominal and gluteal AT biopsies [23 (link)] and preadipocytes [21 (link)] and reverse transcribed as previously described. Complementary (c) DNA was synthesised from total RNA using the High Capacity cDNA Reverse Transcription Kit (Life Technologies, Warrington, UK). Quantitative (q) PCR was performed in triplicate on cDNA diluted 1/20 with Kapa Probe Fast Mastermix (Kapa Biosystems, Wilmington, Massachusetts, USA) in an 8 µl reaction. The following TaqMan Assays-on-Demand (Applied Biosystems) were used: ADIPOQ (Hs00605917_m1); BMP2 (Hs00154192_m1); BMPR1A (Hs01034913_g1); BMPR1B (Hs01010965_m1); BMPR2 (Hs00176148_m1); SMAD6 (Hs00178579_m1); GREM1 (Hs01879841_s1); GREM2 (Hs03986140_s1); ID1 (Hs03676575_s1); PPARG2 (Hs01115510_m1); 18 s (Hs99999901_s1) and PPIA (Hs99999904_m1). Data were captured on an ABI Prism 7900HT. Relative transcript expression was calculated using the ΔΔCt relative quantification method [24 (link)] where ΔCt = Assay efficiency^{(min Ct – Sample Ct)}. The ΔCt values of target genes were normalised to ΔCt values of a stably expressed reference transcript; 18 s was used for 14 day BMP2 treatments, PPIA was used for all other experiments.

First-strand cDNA was synthesized from 0.5 μg of total RNA using a High Capacity Reverse Transcription kit. SYBER Green qRT-PCR reactions were performed in triplicate using a 1:10 dilution of cDNA with custom-designed primers [HRPT1 (hypoxanthine phosphoribosyltransferase-1): forward TTGCTTTCCTTGGTCAGGCA, reverse ATCCAACACTTCGTGGGGTC; HNF1 (hepatocyte nuclear factor 1): forward TCCTTCCAGCTAGTGACCCA, reverse CAGGCTCTGGCACAGAGTAG]. Reactions were carried out using a Rotor-Gene 6000 machine. TAQMAN qRT-PCR reactions were performed in triplicate using a 1:30 dilution of cDNA and Applied Biosystems assays (Table 1) and KAPA Probe Fast Master Mix (KAPA Biosystems). Reactions were run on an Applied Biosystems 7900HT machine. To adjust for variations in the cDNA synthesis, each gene was normalized to that of hypoxanthine-guanine phosphoribosyltransferase-1 (HPRT1) and or GAPDH mRNA using the comparative (ΔΔC_T) method (41 (link)).

Cells were washed in PBS and harvested in Tri-Reagent (Ambion, AM9738) by scraping. Total RNA was extracted and quantified (Nanodrop) before using 750 ng to synthesize cDNA (High Capacity cDNA Reverse Transcription Kit, Life Technologies, UK, 4368813). qPCR was performed on a 1/40 cDNA dilution using Taqman Assays-on-Demand (Applied Biosystems: CEBPA- Hs0029972_m1, CEBPB- Hs00942496_s1, PPARG- Hs01115729_m1, ADIPOQ- Hs00605917_m1, LEP- Hs00174877m1, INSR- Hs00961557_m1, GLUT4- Hs00168966_m1, FASN- Hs00188012_m1, ELOVL6- Hs00907564_m1, SCD- Hs00748952_m1, DGAT2- Hs01017541_m1, PNPLA2- Hs00386101_m1, PLIN1- Hs00160173_m1, LIPE- Hs00193510_m1) and Kapa Probe Fast Mastermix (Kapa Biosystems) on a QuantStudio 7 Flex (ABI). Triplicate reactions were performed in a final volume of 6 µL. Relative transcript expression was calculated using the ΔΔCt relative quantification method [26 (link)]. The ΔCt values of target genes were normalized to the ΔCt (geometric mean) of reference transcripts 18S, PGK1, PPIA and UBC.

Total RNA was extracted using the Trizol reagent (Life Technologies, Italy) according to the manufacturer’s protocol. First-strand complementary DNA was synthesized using SuperScript VILO cDNA synthesis kit (Life Technologies). qRT-PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, NJ, USA) with a 7500 Fast Real-Time PCR System (Applied Biosystems) according to the manufacturer’s instructions. The mRNA expression levels were determined by normalizing to cyclophilin-A mRNA expression. The primers employed for qRT-PCR were as follows: ET_AR Fw: 5′-GGGATCACCGTCCTCAACCT-3′; ET_AR Rev: 5′-CAGGAATGGCCAGGATAAAGG-3′; ZEB1 Fw: 5′-GCAGTCCAAGAACCACCCTT-3′; ZEB1 Rev: 5′-GGGCGGTGTAGAATCAGAGT-3’; pri-miR-200b Fw: 5’-AGCAGCTCCTGGAAC-3′; pri-miR-200b Rev: 5′-CACGTGCTGCCTTGT-3′; pri-miR-200c Fw: 5′-AGCCAGGGATCTGCA-3′; pri-miR-200c Rev: 5′-ACCTTGGGTCAGGCA-3′; cyclophilin-A Fw: 5′-TTCATCTGCACTG CCAAGAC-3′; cyclophilin-A Rev: 5′-TCGAGTTGTCCACAGTCAGC-3′. For miRNA analysis RNA was reverse transcribed using the hsa-miR-141, hsa-miR-200a, hsa-miR-200b, hsa-miR-200c, hsa-miR-429, or U6 snRNATaqMan MicroRNA Assay systems (Applied Biosystems) and qRT-PCR was performed by using Kapa Probe Fast Master Mix (KapaBiosystems, MA, USA). miRNA levels were normalized to U6 snRNA. Final data were obtained by using 2^−ΔΔCt method.