To determine the effects of hyperosmolar potassium gluconate on the metabolic activity of fibroblasts, a metabolism assay was performed at the end of both the growth phase and differentiation phase of HFFs. Fibroblasts were seeded in 96 well plates and followed the same cell culture protocols. At the end of the culture period, medium was replaced with medium supplemented with the cell counting kit 8 (CCK-8) reagent (Sigma-Aldrich), and the assay was performed according to the manufacturer’s instructions. Blank wells were subtracted out of the readings and then data were normalized to the metabolic activity of control fibroblasts cultured in GM for the duration of the experiment. Each experimental condition was performed in quadruplicate.
Cck 8 reagent
Manufactured by Merck Group
Sourced in United States, Switzerland, Germany
The CCK-8 reagent is a colorimetric assay kit used for the determination of cell viability and cytotoxicity. It utilizes a water-soluble tetrazolium salt that is reduced by cellular dehydrogenases, producing a water-soluble formazan dye that can be measured spectrophotometrically. The amount of the formazan dye generated is directly proportional to the number of living cells.
Automatically generated - may contain errors
Lab products found in correlation
Microplate reader, by Agilent Technologies (14 mentions)
Microplate reader, by Bio-Rad (11 mentions)
Microplate reader, by Thermo Fisher Scientific (6 mentions)
Microplate reader, by Tecan (3 mentions)
Elx800, by Agilent Technologies (3 mentions)
Elx800 microplate reader, by Agilent Technologies (3 mentions)
Synergy 2 multi mode microplate reader, by Agilent Technologies (2 mentions)
Cxcl12, by Thermo Fisher Scientific (2 mentions)
Elx800 absorbance microplate reader, by Agilent Technologies (2 mentions)
Fluostar omega, by BMG Labtech (2 mentions)
Fitc conjugated anti rabbit igg, by Thermo Fisher Scientific (1 mentions)
Afatinib, by MedChemExpress (1 mentions)
On targetplus smartpool sirna, by Horizon Discovery (1 mentions)
Softmax pro v 6, by Molecular Devices (1 mentions)
96 well microplate, by Corning (1 mentions)
Triple solution, by Merck Group (1 mentions)
Model 8, by Bio-Rad (1 mentions)
Microscope reader, by Thermo Fisher Scientific (1 mentions)
Microplate spectrophotometer, by Tecan (1 mentions)
Infinite m200, by Tecan (1 mentions)
152 protocols using cck 8 reagent
1
Evaluating Fibroblast Metabolic Activity
2
Cell Viability Determination by CCK-8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After mechanical stimulation, BMDMs were incubated with 2 ml fresh medium and 200 μl CCK-8 reagent (#96,992, Sigma-Aldrich, USA) under 37 °C for 30 min, and then the absorbance was measured at 450 nm.
3
Cell Proliferation Assay with CCK-8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2×103 cells hKIF18B or control cells were seeded into 96-well with 200μL complete medium. After 48 h, according to the instruction, the 10 μL CCK-8 reagent (96,992, Sigma) was added into each well and incubator for 4 h. Then, OD450 value was examined using the enzyme mark instrument.
4
Modulation of DSE-Mediated Signaling Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant HB-EGF, NRG1, and EGF protein were purchased from PeproTech. Full length DSE-pcDNA3.1 plasmid was purchased from GeneScript. Two pLKO.1/DSE-shRNA plasmids (DSE sh1, 5’- CAGAAAGAACTACCCATAGAT -3’; DSE sh2, 5’- CAGAAAGAACTACCCATAGAT -3’) and nontargeting pLKO.1 plasmids were purchased from National RNAi Core Facility (Academia Sinica, Taipei, Taiwan). ON-TARGETplus SMARTpool siRNA against human DSE was purchase from Dharmacon. CCK8 reagent was purchased from Sigma-Aldrich. Rabbit polyclonal anti-DSE antibody was purchased from Sigma-Aldrich. The immunogen of this DSE antibody is from human DSE sequence which is 87% identical to mouse Dse sequence. Antibodies against p-AKT, p-ERK1/2, ERK1/2, p-EGFR (Y1068), EGFR, and p-ErbB2(Y1248) were purchased from Cell Signaling Technology. Antibodies against total AKT and Actin were purchased from GeneTex, Inc. Antibody against ErbB2 was purchased from Santa Cruz Biotechnology. FITC conjugated anti-rabbit IgG was purchased from Invitrogen. HRP conjugated-DS binding protein was purchased from Lifespan Technologies. The dual EGFR/HER2 inhibitor, Afatinib, was purchased from MedChemExpress.
5
Cell Proliferation Quantification with CCK-8
6
Combinatorial Evaluation of Olaparib and SP600125
7
Cell Viability Assay using CCK-8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CCK-8 reagent was purchased from Sigma. Cells seeded into a 96-well plate with a density of 2000 cells per well were maintained for the indicated days, followed by 10 μl CCK-8 reagent added to each well and incubated at 37°C for 3 h. The absorbance at 450 nm was measured using a microplate reader.
8
Cell Viability Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The assay was adapted from a previous report [21 (link)]. Briefly, treated cells (5,000 cells/well) were inoculated into 96 wells culture plate in triplicate. The cells were maintained at 37°C for the indicated times. After 0, 24, 48, and 72 h, CCK-8 reagent (Sigma) was added to the cells to cultivate cells for two more hours. Finally, the absorbance of each well was measured at a wavelength of 450 nm using a microplate reader (Thermo Fisher Scientific). A cell viability curve was generated by plotting the optical density (OD450) values against time.
9
Evaluating PSP-2 Cytotoxicity in EAhy926 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EAhy926 cells were seeded into a non-coated 96 well plate (Techno Plastic Products AG, Trasadingen, Switzerland) in full media. After cells reached confluency, the growth medium was replaced with media containing DMSO ± PSP-2 at final concentrations of 5, 10, and 20 µM, and the cells were incubated for another 24 h. CCK-8 reagent (Sigma, Buchs SG, Switzerland) was added to the media one hour before the viability was assessed by measuring the OD at 450 nm.
10
Cell Viability Assessment via CCK-8 Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Cell Counting Kit-8 (CCK-8) assay (which uses WST-8 for the colorimetric reaction) was performed to assess cell viability. Briefly, RAW264.7 macrophages (4×104 cells/ml) were seeded into 96-well plates (100 µl/well) and treated with different concentrations of ARR (5, 10, 20, 40, 80, 100 or 200 µg/ml) for 24 h at 37°C. Following the incubation, 10 µl CCK-8 reagent (Sigma-Aldrich; Merck KGaA) was added to each well and incubated for an additional 2 h at 37°C. In the presence of the electronic coupling reagent, 1-Methoxy PMS, WST-8 was transformed to orange-yellow water-soluble formazan. The optical density was determined using a microplate reader at a wavelength of 450 nm.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!