Glomax tm 20 20 detection system

The human EPG5 wild type or mutated 3'-UTR sequence containing the miR-150 binding site was cloned into the psiCHECK-2 vector. The primer sequences are listed in Table S1. Cells were seeded into 24-well plates and co-transfected with pri-miR-150 or control vector and wild-type or mutated EPG5 3'-UTR using Lipofectamine 3000. Both firefly and Renilla luciferase activities were measured after the 48 h transfection using the Dual-Luciferase Reporter 1000 Assay System (Promega, WI, USA) and were detected by the GloMax TM 20/20 detection system (E5331, Promega, WI, USA) according to the manufacturer's instructions. Luciferase activities were normalized to Renilla luciferase.

The procedure used has been described in detail in our earlier study22 (link). The human FOXO4 wild type or mutated 3′-UTR sequence containing the miR-150 binding site was cloned into the psiCHECK-2 vector. The primer sequences are listed in Supplementary Table 1. Cells were seeded into 24-well plates and co-transfected with miR-150 or control vector and wild-type or mutated foxo4 3′-UTR using Lipofectamine 2000. Both firefly and Renilla luciferase activities were measured after the 48 h transfection using the Dual-Luciferase Reporter 1000 Assay System (Promega, USA) and were detected by the GloMax TM 20/20 detection system (E5331, Promega, USA) according to the manufacturer’s instructions. Luciferase activities were normalized to Renilla luciferase.

To construct IFIT2-3′UTR plasmid, a wild-type 3′-UTR fragment of human IFIT2 mRNA (1226–1233 nt, Genbank accession no. NM_001547.4) containing the putative miR-645 binding sequence was amplified by RT-PCR and cloned into the site between Xho I and Not I downstream of the luciferase reporter gene of the psiCHECK™ vector (Promega, USA). A mutant of the single miR-645 binding site (5′- AGCCTAG −3′ to 5′- TCGGATC −3′) in the 3′-UTR of IFIT2 was included by Site-Directed Mutagenesis Kit (SBS Genetech, Beijing, China). Wild and mutant types of pmirGLO-IFIT2-UTR vectors were validated by DNA sequencing.
The nucleotide sequences of primers for IFIT2-3′UTR (WT) clone:
IFIT2XhoIF2: 5′CCGCTCGAG AGAATAGAGATGTGGTGCCCACTAGGCTACTGCTG 3′.
IFIT2NotIR2: 5′ATAAGAATGCGGCCGC TTAAAATGGAATCAGTGACTTTTATTTCTCATAACAGAG 3′.
The nucleotide sequences of primers for IFIT2-3′UTR (MT) clone:
mutIFIT2F2: 5′TTCTAGGTAGATGCTGAATTCGGATCACATCAAAGTTGGTGTGAAC 3′.
mutIFIT2R2: 5′GTTCACACCAACTTTGATGTGATCCGAATTCAAGEJTCTACCTAGAA 3′.
Cells were transfected with the miR-645 mimics, NC and pmirGLO plasmid in 24-well plates using lipofectamine™ 2000 (Invitrogen) according to the instructions. 48 h later, cells were harvested and analyzed for luciferase activity using the Dual-Luciferase Reporter Assay System (Promega, USA) and detected by the GloMaxTM 20/20 detection system (E5331, Promega).