Primescript one step rt pcr kit ver 2

Manufactured by Takara Bio

Sourced in China, Japan

The PrimeScript One Step RT-PCR Kit Ver.2 is a reagent kit designed for reverse transcription and polymerase chain reaction (RT-PCR) in a single reaction. It enables the conversion of RNA to cDNA and subsequent amplification of the target sequence.

Automatically generated - may contain errors

Lab products found in correlation

79 protocols using primescript one step rt pcr kit ver 2

Notch2 Expression Construct Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human Notch2-cDNA fragment was amplified by using a forward primer 5′-ATTTGCGGCCGCGCCA
TGCGAAAGCGTAAGC-3′ as well as a reverse primer 5′- CCGCTCGAGCGCATAAACCTGCATGTTGTTGTGT -3′, confirmed by sequencing, and then digested by Not I and Xho I-. The 2.3-kb fragment was purified using a PrimeScriptTM One Step RT-PCR Kit Ver.2.0 (Takara, Japan) and was ligated to a Not I –Xho I-digested pCMV-Tag4 vector DNA (Clontech, Mountain View, CA, United States) to construct Notch2/pCMV-Tag4. Positive clones were further verified by Not I -Xho I digestion, sequencing and PCR.

Li Y., Ye J., Chen Z., Wen J., Li F., Su P., Lin Y., Hu B., Wu D., Ning L., Xue Q., Gu H, & Ning Y. (2017). Annonaceous acetogenins mediated up-regulation of Notch2 exerts growth inhibition in human gastric cancer cells in vitro. Oncotarget, 8(13), 21140-21152.

+ Open protocol

+ Expand

Quantification of HIV-1 Viral Load

Check if the same lab product or an alternative is used in the 5 most similar protocols

5ml peripheral blood from each patient was collected into red-top tubes containing anticoagulant. After centrifugation, 2ml plasma was collected and stored at -80°C. HIV-1 viral RNA was extracted from plasma with the High Pure Viral RNA kit (Roche) according to manufacturer’s instruction. cDNA synthesis and the amplification of first round PCR products of the nested PCR were prepared by PrimeScript^TM one step RT-PCR kit Ver.2.0 (Takara) following the manufacturer’s instruction. In detail, the reaction mixture (25μl) for cDNA synthesis and first round PCR contained 5μl extracted viral RNA (4–25μg/ml) and 0.4μM first round PCR primers. The viral load of each specimen was determined by careHIV-1 RT-PCR Assay (Qiagen) and analyzed by Lightcycler (Roche) following the manufacturer’s instruction.

Cheung K.W., Peng Q., He L., Cai K., Jiang Q., Zhou B., To S.W., Yam W.C., Liu L., Chen Z, & Wang H. (2016). Rapid and Simultaneous Detection of Major Drug Resistance Mutations in Reverse Transcriptase Gene for HIV-1 CRF01_AE, CRF07_BC and Subtype B in China Using Sequenom MassARRAY® System. PLoS ONE, 11(4), e0153641.

+ Open protocol

+ Expand

Enterovirus Genotyping by VP1 Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was extracted from the cell culture supernatants with a QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer’s instructions. The enterovirus universal primer pairs 222 and 224 were used to amplify the partial VP1 gene sequence^{33 (link)} using a PrimeScript^TM One-Step RT-PCR Kit Ver.2 (Takara, Dalian, China). The positive PCR products were sequenced using an ABI 3730XL automatic sequencer (Applied Biosystems, Foster City, CA, USA) at the Tsingke Sequencing Company (Kunming, China).
The partial VP1 nucleotide sequence (nucleotide position 2617–3273) was analysed using the Enterovirus Genotyping Tool for serotyping^{34 (link)}. Virus strains showing >75% nucleotide sequence identity with a known enterovirus serotype were designated the relative serotype of EVs. Estimates of average evolutionary divergence of the sequence pairs within and between E-12 genotypes were performed using MEGA6 (Table 1). The analyses were conducted using the Tamura-Nei model. The rate variation among the sites was modelled with a gamma distribution (shape parameter = 1).

Liu H., Zhang J., Zhao Y., Zhang H., Lin K., Sun H., Huang X., Yang Z, & Ma S. (2018). Molecular characterization of echovirus 12 strains isolated from healthy children in China. Scientific Reports, 8, 11716.

+ Open protocol

+ Expand

Molecular Serotyping of Viral Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols

For molecular serotyping, the viral RNAs were extracted from cell culture supernatants with a QIAamp Viral RNA Mini Kit (QIAGEN, Valencia, CA, USA). Reverse transcription-polymerase chain reaction (RT-PCR) was carried out using a PrimeScript^TM One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China) with primer pairs 222 and 224^{37 (link)}. The PCR-positive products were sequenced using an ABI 3730XL automatic sequencer (Applied Biosystems, Foster City, CA, USA) at BGI Sequencing Company (Beijing, China). The partial VP1 sequences were compared with sequences from GenBank using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/).

Zhang H., Zhao Y., Liu H., Sun H., Huang X., Yang Z, & Ma S. (2017). Molecular characterization of two novel echovirus 18 recombinants associated with hand-foot-mouth disease. Scientific Reports, 7, 8448.

+ Open protocol

+ Expand

Whole-Genome Sequencing of E-18 Strain

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two long-distance PCR amplifications were performed using a PrimeScript^TM One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China). The primers used for RT-PCR and sequencing of the full-length genome were designed by a “primer-walking” strategy^{38 (link)} and are listed in Table 3. The PCR products were purified using the QIAquick PCR purification kit (Qiagen, Germany), and sequenced in both directions at least two from each strand using ABI 3130 Genetic Analyser (Applied Biosystems, USA).Table 3

Primers used for complete genome amplification and sequencing.

primer	Sequence (5′-3′)	Nucleotide position*	Orientation
224	GCIATGYTIGGIACICAYRT	1977–1996	Forward
222	CICCIGGIGGIAYRWACAT	2969–2951	Reverse
E181F	TTAAAACAGCCTGTGGGTTG	1–20	Forward
E181R	TGTGCCATGAAGGGTGTA	2431–2414	Reverse
E181r	GGAACGCGGTGACTCATC	340–323	Reverse
E181f	CTATAAGGATGCGGCATC	839–856	Forward
E182F	CATAAACGTTAGGGAGA	2714–2730	Forward
E182f	GTACTTCTCGCAGCTGGG	3600–3617	Forward
E184f	CAGAGTGATCAAGAGCA	4263–4269	Forward
E185r	CCCAACTGGGATGTACAT	5749–5732	Reverse
E186r	CCTGGGTTTTGGTGAAAG	6520–6503	Reverse
E187f	GACAAGGGAGAGTGTTT	7018–7034	Forward
E188R	ACCGAATGCGGAGAATTTAC	7410–7391	Reverse

*Numbering according to the genome of E-18 strain E18-314/HB/CHN/2015.

+ Open protocol

+ Expand

Complete Genome Sequencing of HCoV-NL63

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HCoV-NL63 isolate from the Netherlands (HCoV-NL63_Amsterdam 1, GenBank accession number: NC_005831) served as the reference strain. Eighteen primer pairs covering overlapping regions were designed using the Blast-Primer web tool. RT-PCR was employed to amplify specific segments with overlapping regions, encompassing all protein-coding genes except the 5’ untranslated regions (UTR) and 3’ UTR. Primer pairs and amplification details are provided in Table 1. Samples with Ct values ≤25 from human coronavirus HCoV-NL63 real-time RT-PCR were selected, and the TAKARA PrimeScriptTM One Step RT-PCR kit Ver. 2 was used for RT-PCR amplification. The amplified segments were subjected to Sanger sequencing by Qingke Biosciences Co., Ltd.

Zhu R., Cao R., Wang L., Gong Y., Cheng Q., Long H., Xia D., Song Q., Xia Z., Liu M., Du H., Song J., Han J, & Gao C. (2024). Seasonal human coronavirus NL63 epidemics in children in Guilin, China, reveal the emergence of a new subgenotype of HCoV-NL63. Frontiers in Cellular and Infection Microbiology, 14, 1378804.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from fresh frozen tissues or cells according to the instructions of the Trizol kit (Invitrogen, Carlsbad, CA, USA). The RNA was then dissolved in 1× RNA-enzyme-free diethylpyro carbonate (DEPC). Checking the OD values of RNA at the wavelengths of 260 nm and 280 nm via ND-1000 ultraviolet/visible spectrophotometer (Nanodrop Company, Rockford, IL, USA) to evaluate the quality and concentration of the total RNA. Then cDNA amplification efficiency was evaluated using PrimeScriptTM One Step RT-PCR Kit Ver.2 (TaKaRa) followed the manufacturer’s instructions. Data were analyzed using 2^−ΔCt for patient samples and 2^−ΔΔCt for cell lines. The primer sequences can be seen in Table 1.

Zeng F., Yao M., Wang Y., Zheng W., Liu S., Hou Z., Cheng X., Sun S., Li T., Zhao H., Luo Y, & Li J. (2021). Fatty acid β-oxidation promotes breast cancer stemness and metastasis via the miRNA-328-3p-CPT1A pathway. Cancer Gene Therapy, 29(3-4), 383-395.

+ Open protocol

+ Expand

Confirmation of HeAstV1 Genome Structure

Check if the same lab product or an alternative is used in the 5 most similar protocols

Since the genome structure of Hippocampus erectus astro-like virus 1 (abbreviated as HeAstV1) is distinct from other members of the family Astroviridae, RT-PCR of the original sample was performed using the PrimeScript^TM One Step RT-PCR Kit Ver.2 (TaKaRa, Beijing, China), with primers designed based on the obtained consensus sequence to further confirm the viral genome (Table S2). RT-PCR was initiated at 50 °C for 30 min and 94 °C for 2 min, followed by 30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min. If the concentration of the RT-PCR product of the first round was low, nested PCR was performed using Premix Taq^TM (TaKaRa, Beijing, China). The reaction conditions for nested PCR were 30 cycles of 98 °C for 10 s, 60 °C for 30 s, and 72 °C for 1 min. The final products were sequenced and compared with the original template.

Zhang F., Ren Z., Guo X., Wang Y., Meng F., Shi W., Wang X, & Dong X. (2023). Meta-Transcriptomic Analysis Reveals Novel RNA Viruses in Hippocampus erectus. Viruses, 15(3), 772.

+ Open protocol

+ Expand

mRNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total messenger RNAs were extracted from cells using RiboEx (Geneall, South Korea) and Hybrid-R^TM extraction kit (Geneall, South Korea) according to manufacturer’s instruction. The concentration of total mRNA was measured by Nonodrop spectrometer (Thermoscinetific). Generation of first strand cDNA from total mRNA and amplification of this cDNA strand were reacted together using Prime Script^TM one step RT-PCR kit Ver2 (TAKARA, Japan) and PCR machine (Bio-rad, Richmond, USA) according to manufacturer’s instructions. Differently expressed PCR products were separated by 1.2% agarose gel electrophoresis. Specific primer sequences are as followed: FN1 fwd, 5′-AAACTGCAAACTCCGTCACC-3′; FN1 rev, 5′-AGACAGAGGGACCCAACTTG-3′ GAPDH fwd, 5′-GTCAGTGGTGGACCTGACCT-3′; GAPDH rev, 5′-AGGGGAGATTCAGTGTGGTG-3′

Park H.J, & Helfman D.M. (2019). Up-regulated fibronectin in 3D culture facilitates spreading of triple negative breast cancer cells on 2D through integrin β-5 and Src. Scientific Reports, 9, 19950.

+ Open protocol

+ Expand

VP1 Sequencing of Enteroviruses

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was extracted from the cell cultures using the QIAamp Viral RNA Mini Kit (Qiagen, Germany). Reverse transcription PCR was performed to amplify the complete VP1 coding region using the PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian,China) with primers 490–493 [25 (link)]. The amplicons were sequenced using ABI 3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA) to harvest the complete VP1 region. The acquired VP1 sequences were analyzed with the BLAST server by comparing the identity of sequences available in the GenBank and were determined using the EV Genotyping Tool [26 (link)].

Han Z., Zhang Y., Huang K., Wang J., Tian H., Song Y., Yang Q., Yan D., Zhu S., Yao M., Wang X, & Xu W. (2019). Two Coxsackievirus B3 outbreaks associated with hand, foot, and mouth disease in China and the evolutionary history worldwide. BMC Infectious Diseases, 19, 466.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!